SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma14g04350

Feature Type:gene_model
Chromosome:Gm14
Start:2940438
stop:2943576
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G12110AT Annotation by Michelle Graham. TAIR10: Glutathione S-transferase, C-terminal-like;Translation elongation factor EF1B/ribosomal protein S6 | chr5:3914483-3915732 FORWARD LENGTH=228 SoyBaseE_val: 2.00E-106ISS
GO:0006414GO-bp Annotation by Michelle Graham. GO Biological Process: translational elongation SoyBaseN/AISS
GO:0009407GO-bp Annotation by Michelle Graham. GO Biological Process: toxin catabolic process SoyBaseN/AISS
GO:0010583GO-bp Annotation by Michelle Graham. GO Biological Process: response to cyclopentenone SoyBaseN/AISS
GO:0005853GO-cc Annotation by Michelle Graham. GO Cellular Compartment: eukaryotic translation elongation factor 1 complex SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0003746GO-mf Annotation by Michelle Graham. GO Molecular Function: translation elongation factor activity SoyBaseN/AISS
KOG1668 KOG Elongation factor 1 beta/delta chain JGI ISS
PTHR11595Panther ELONGATION FACTOR 1-BETA JGI ISS
PTHR11595:SF5Panther ELONGATION FACTOR 1-BETA JGI ISS
PF00736PFAM EF-1 guanine nucleotide exchange domain JGI ISS
UniRef100_B7FMR1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Elongation factor 1-beta n=1 Tax=Medicago truncatula RepID=B7FMR1_MEDTR SoyBaseE_val: 5.00E-116ISS
UniRef100_I1M786UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M786_SOYBN SoyBaseE_val: 4.00E-159ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g04350 not represented in the dataset

Glyma14g04350 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma02g44460 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.14g039100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma14g04350.1   sequence type=CDS   gene model=Glyma14g04350   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGTCACCTTCTCAGATCCTCACACCGAAGAGGGCATCAAATCCCTCGATCAATTCCTTTCTGGGAAAACCTATATCTCTGGGGATCAATTGACAAAGGATGATATCAAAGTGTATGCAGCTGTTGTGGAAAAGCCAGGAGACTCTTTTCCTAATGCTGCTAAGTGGTACGATGCCGTCTCTTCTCAACTTGCTCCAAGCTTCCCTGGGCACGCTCAAGGGGTAAGATTCAGTGGCGCTGCTGCTCCAGCTGAAGCTGCACCTGCCAAAGCGGCTGCCACTGCTGAAGAAGATGATGATGATCTTGATCTCTTTGGTGATGAGACAGAGGAGGATAAGAAGGCAGCAGAGGAAAGGGAGGCTGCTAAAAAGCCTGCCAAGAAAAAAGAGAGTGGCAAGTCTTCTGTCCTTCTCGATGTTAAGCCTTGGGACGATGAGACCGACATGAAGAAGCTGGAAGAGGCTGTCCGTAGTATTGAGATGCCTGGTTTATTGTGGGGAGCATCCAAACTAGTTCCCGTGGGATATGGTATCAAGAAGTTGCAGATCATGATGACTATTGTTGATGACCTTGTATCAGTGGACACTCTTGTTGAGGAACGCTTGACAGTTGAGCCATGCAACGAGTATATCCAGAGCTGTGACATTGTTGCATTCAACAAAATCTAA

>Glyma14g04350.1   sequence type=predicted peptide   gene model=Glyma14g04350   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAVTFSDPHTEEGIKSLDQFLSGKTYISGDQLTKDDIKVYAAVVEKPGDSFPNAAKWYDAVSSQLAPSFPGHAQGVRFSGAAAPAEAAPAKAAATAEEDDDDLDLFGDETEEDKKAAEEREAAKKPAKKKESGKSSVLLDVKPWDDETDMKKLEEAVRSIEMPGLLWGASKLVPVGYGIKKLQIMMTIVDDLVSVDTLVEERLTVEPCNEYIQSCDIVAFNKI*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo