SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g10740

Feature Type:gene_model
Chromosome:Gm08
Start:7814033
stop:7816236
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g10740
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G40780AT Annotation by Michelle Graham. TAIR10: lysine histidine transporter 1 | chr5:16323823-16327082 FORWARD LENGTH=445 SoyBaseE_val: 0ISS
GO:0006499GO-bp Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006820GO-bp Annotation by Michelle Graham. GO Biological Process: anion transport SoyBaseN/AISS
GO:0006862GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide transport SoyBaseN/AISS
GO:0006865GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid transport SoyBaseN/AISS
GO:0006888GO-bp Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0015696GO-bp Annotation by Michelle Graham. GO Biological Process: ammonium transport SoyBaseN/AISS
GO:0015802GO-bp Annotation by Michelle Graham. GO Biological Process: basic amino acid transport SoyBaseN/AISS
GO:0030968GO-bp Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0043090GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid import SoyBaseN/AISS
GO:0043269GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of ion transport SoyBaseN/AISS
GO:0080167GO-bp Annotation by Michelle Graham. GO Biological Process: response to karrikin SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0015171GO-mf Annotation by Michelle Graham. GO Molecular Function: amino acid transmembrane transporter activity SoyBaseN/AISS
KOG1303 KOG Amino acid transporters JGI ISS
PTHR22950Panther AMINO ACID TRANSPORTER JGI ISS
PF01490PFAM Transmembrane amino acid transporter protein JGI ISS
UniRef100_G7ZZ20UniRef Annotation by Michelle Graham. Most informative UniRef hit: Lysine/histidine transporter (Fragment) n=1 Tax=Medicago truncatula RepID=G7ZZ20_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1KRZ0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1KRZ0_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma08g10740
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g10740 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g101900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g10740
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g10740
>Glyma08g10740.1   sequence type=CDS   gene model=Glyma08g10740   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAACTGAAACTGAAAATGCTAATGATGCTGATATAAAGGCCATTAATGATTGGCTTCCTGTCACTGCCTCCCGAAATGCCAAATGGTGGTACTCTGCCTTCCACAACATCACTGCCATGGTTGGTGCTGGTGTCCTCACCCTTCCTTATGCCATGTCTATGATGGGCTGGGGTCCGGGGACAGTTATACTGCTCTTGTCATGGATGATCACGTTGTTTACCCTATGGCAAATGGTTGAGATGCACGAAATGGTACCTGGTGTGAGATTCGATAGGTATCATGAATTGGGGCAGCATGCCTTTGGAGAGAAGTTGGGTCTCTACATTGTGATTCCTCAACAACTACTTGTTCAGGTTGGCACATGCATTGTATATATGGTCACAGGAGGAACATCGCTAAAGAAGTTTCATGACACGGTTTGCCCCTCGTGTCAAAACATTAGGACCTCCTATTGGATTGCTATCTTTGGTTTTGTAAACTTCGTCCTCTCTTTGTGCCCCAACTTCAACTCTATTTCTGCTGTCTCTTTTGCCGCAGCAGTCATGTCTATCGCTTACTCAACCATTGCTTGGGTGGCTTCCATTGGCAAGGGAAAACTACCAGATGTGGACTATGGCTACAAAGCCCACAGCACTGCCGATGGTGTATTCAACTTCATGTTGGCCTTGGGAGAGGTGGCATTCTCCTATGCAGGTCACAATGTGGTTTTGGAAATCCAAGCAACAATACCTTCTACTCCTGAGAAACCTTCCAAGAAAGCCATGTGGAAAGGAGTTATATTTGCCTATTTAGGAGTTGCCTTTTGCTATCTCCCTGTGGCCTTCATTGGATATTATATATTTGGCAACTCTGTCCAGGATAATATCCTCATCACACTAGAAAAACCAACTTGGCTCATTGCTGCAGCCAACATGTTTGTTATTGTCCATGTTATTGGAGGCTATCAGGTATTCTCAATGCCGGTGTTTGACATCATCGAAACCTTTTTGGTGAAGCATTTAAAGTTTTCTCCTTGTTTTACACTCCGCTTTGTTGCTCGCACTGTATTTGTAGCAATGTCAATGTTAATTGCCATATGCATCCCGTTCTTCGGTTCTCTTCTTGGATTTCTAGGAGGATTTGCCTTTGCCCCAACATCATACTTTCTACCCTGTATCATCTGGCTTAAACTCTACAAACCAAAGAGATTTAGTTTGTCTTGGATAGTCAATTGGACATGCATTGTGCTTGGGATGCTATTGATGATACTAGCTCCAATTGGTTCGTTGAGAAAAATCATTGTTTCAGCGGCGAATTACAAGTTCTTTTCGTGA
Predicted protein sequences of Glyma08g10740
>Glyma08g10740.1   sequence type=predicted peptide   gene model=Glyma08g10740   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
METETENANDADIKAINDWLPVTASRNAKWWYSAFHNITAMVGAGVLTLPYAMSMMGWGPGTVILLLSWMITLFTLWQMVEMHEMVPGVRFDRYHELGQHAFGEKLGLYIVIPQQLLVQVGTCIVYMVTGGTSLKKFHDTVCPSCQNIRTSYWIAIFGFVNFVLSLCPNFNSISAVSFAAAVMSIAYSTIAWVASIGKGKLPDVDYGYKAHSTADGVFNFMLALGEVAFSYAGHNVVLEIQATIPSTPEKPSKKAMWKGVIFAYLGVAFCYLPVAFIGYYIFGNSVQDNILITLEKPTWLIAAANMFVIVHVIGGYQVFSMPVFDIIETFLVKHLKFSPCFTLRFVARTVFVAMSMLIAICIPFFGSLLGFLGGFAFAPTSYFLPCIIWLKLYKPKRFSLSWIVNWTCIVLGMLLMILAPIGSLRKIIVSAANYKFFS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo