Glyma14g04350 - SoyBase

SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma14g04350

Feature Type:	gene_model
Chromosome:	Gm14
Start:	2940438
stop:	2943576
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g04350

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G12110	AT	Annotation by Michelle Graham. TAIR10: Glutathione S-transferase, C-terminal-like;Translation elongation factor EF1B/ribosomal protein S6 \| chr5:3914483-3915732 FORWARD LENGTH=228	SoyBase	E_val: 2.00E-106	ISS
GO:0006414	GO-bp	Annotation by Michelle Graham. GO Biological Process: translational elongation	SoyBase	N/A	ISS
GO:0009407	GO-bp	Annotation by Michelle Graham. GO Biological Process: toxin catabolic process	SoyBase	N/A	ISS
GO:0010583	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cyclopentenone	SoyBase	N/A	ISS
GO:0005853	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: eukaryotic translation elongation factor 1 complex	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0003746	GO-mf	Annotation by Michelle Graham. GO Molecular Function: translation elongation factor activity	SoyBase	N/A	ISS
KOG1668	KOG	Elongation factor 1 beta/delta chain	JGI		ISS
PTHR11595	Panther	ELONGATION FACTOR 1-BETA	JGI		ISS
PTHR11595:SF5	Panther	ELONGATION FACTOR 1-BETA	JGI		ISS
PF00736	PFAM	EF-1 guanine nucleotide exchange domain	JGI		ISS
UniRef100_B7FMR1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Elongation factor 1-beta n=1 Tax=Medicago truncatula RepID=B7FMR1_MEDTR	SoyBase	E_val: 5.00E-116	ISS
UniRef100_I1M786	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M786_SOYBN	SoyBase	E_val: 4.00E-159	ISS

Expression Patterns of Glyma14g04350

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma14g04350

Paralog	Evidence	Comments
Glyma02g44460	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma14g04350 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.14g039100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma14g04350

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g04350

Limit To All Plant Sequences

>Glyma14g04350.1   sequence type=CDS   gene model=Glyma14g04350   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGTCACCTTCTCAGATCCTCACACCGAAGAGGGCATCAAATCCCTCGATCAATTCCTTTCTGGGAAAACCTATATCTCTGGGGATCAATTGACAAAGGATGATATCAAAGTGTATGCAGCTGTTGTGGAAAAGCCAGGAGACTCTTTTCCTAATGCTGCTAAGTGGTACGATGCCGTCTCTTCTCAACTTGCTCCAAGCTTCCCTGGGCACGCTCAAGGGGTAAGATTCAGTGGCGCTGCTGCTCCAGCTGAAGCTGCACCTGCCAAAGCGGCTGCCACTGCTGAAGAAGATGATGATGATCTTGATCTCTTTGGTGATGAGACAGAGGAGGATAAGAAGGCAGCAGAGGAAAGGGAGGCTGCTAAAAAGCCTGCCAAGAAAAAAGAGAGTGGCAAGTCTTCTGTCCTTCTCGATGTTAAGCCTTGGGACGATGAGACCGACATGAAGAAGCTGGAAGAGGCTGTCCGTAGTATTGAGATGCCTGGTTTATTGTGGGGAGCATCCAAACTAGTTCCCGTGGGATATGGTATCAAGAAGTTGCAGATCATGATGACTATTGTTGATGACCTTGTATCAGTGGACACTCTTGTTGAGGAACGCTTGACAGTTGAGCCATGCAACGAGTATATCCAGAGCTGTGACATTGTTGCATTCAACAAAATCTAA

Predicted protein sequences of Glyma14g04350

Limit To All Plant Sequences

>Glyma14g04350.1   sequence type=predicted peptide   gene model=Glyma14g04350   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAVTFSDPHTEEGIKSLDQFLSGKTYISGDQLTKDDIKVYAAVVEKPGDSFPNAAKWYDAVSSQLAPSFPGHAQGVRFSGAAAPAEAAPAKAAATAEEDDDDLDLFGDETEEDKKAAEEREAAKKPAKKKESGKSSVLLDVKPWDDETDMKKLEEAVRSIEMPGLLWGASKLVPVGYGIKKLQIMMTIVDDLVSVDTLVEERLTVEPCNEYIQSCDIVAFNKI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain