SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma.09G218700

Feature Type:gene_model
Chromosome:Gm09
Start:44197069
stop:44198702
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G16800.1AT high-affinity nickel-transport family protein JGI N/AIEA
GO:0006824GO-bp cobalt ion transport JGI N/AIEA
GO:0015675GO-bp nickel cation transport JGI N/AIEA
GO:0017004GO-bp cytochrome complex assembly JGI N/AIEA
GO:0055085GO-bp transmembrane transport JGI N/AIEA
GO:0055114GO-bp oxidation-reduction process JGI N/AIEA
GO:0016020GO-cc membrane EnsemblGenomesN/AIEA
GO:0016020GO-cc membrane JGI N/AIEA
GO:0016021GO-cc integral component of membrane EnsemblGenomesN/AIEA
GO:0016021GO-cc integral component of membrane JGI N/AIEA
GO:0015087GO-mf cobalt ion transmembrane transporter activity JGI N/AIEA
GO:0015099GO-mf nickel cation transmembrane transporter activity JGI N/AIEA
GO:0046872GO-mf metal ion binding JGI N/AIEA
PF03824PFAM High-affinity nickel-transport protein JGI N/AIEA

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE


View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.



View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


ParalogEvidenceComments
Glyma.12g033600 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g218700 Wm82.a4.v1ISS As supplied by JGI
Glyma09g35260 Wm82.a1.v1.1IGC As supplied by JGI


>Glyma.09g218700.1 sequence-type=CDS polypeptide=Glyma.09g218700.1.p locus=Glyma.09g218700 ID=Glyma.09g218700.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATTCTCGTCAACGCGCTGTTCCTTCACCTCAATTTCTTCCAGCATGAAACCCCACCCCCTCCATTATCCTATTCTCCTCCCAAAACCCTACCATCCCTTATCCCCTCTCCGTCTCCGCTCACTCCGAATCATTTCCAAAAACCACCAAAGGCAATAACAGCCCGAACATTTGCAATACTCTCTGCTCTTGTTTTGCTCTTAATCCAACCAGCTTTTGCTCCTGCAGCTTTTGCAACGTTTCAAAATGCTGCCAAGACCAGTGGCCCTGCTGCTGCAGCAGTTGGTGGAAAACTAATCCGCACTGAGCTTCTAAGTAGTGCTTGGACTGGTTTCTTTGCCGGTTGCTTGCACACACTATCAGGGCCTGACCACCTTGCAGCTTTGGCTCCATTGTCAATTGGCCGAACCCAAATGGAGAGTGCTGCTGTTGGAGCCCTTTGGGGTTGTGGCCATGATGCCGGTCAAGTTATCTTTGGCTTAATATTTTTGCTCTTAAAAGATCGACTTCACATTGAAATTATCCAAACTTGGGGCACCCGTGTGGTTGGCCTTACCCTGCTAGTAATTGGTGCTATGGGAATTAAGGAAGCTTCAGAAGTGCCTATCCTGTGTGTTGCCTTAGAAAATGGTGAATGTGATGTTAGCGTCTATGAATCACGCGATAGTAATCCTGTTGTAGGAAAGAAGAAGATTGGTTTTGCTACTTTTGCCACTGGAATAGTTCATGGACTGGAACCAGATGCATTGATGATGGTGTTGCCTGCCCTTGCTCTACCTTCACGCTTGGCTGGTGCTGCATTTCTCATCATGTTCTTACTGGGAACTGTTGTTGCAATGGGGAGCTATACGGTATTTATTGGTTCATGTAGCGAGGCACTAAAAGATAGAGTACCTAGAATAACTGAGAAACTCACTTGGGCTTCTTCTCTTGTTGCAATAGCCCTCGGATTTGCCATCATCACTAGCCAGTTTTTTGGGTTTAGCCTGTATTAG

>Glyma.09g218700.1.p sequence-type=predicted peptide transcript=Glyma.09g218700.1 locus=Glyma.09g218700 ID=Glyma.09g218700.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ILVNALFLHLNFFQHETPPPPLSYSPPKTLPSLIPSPSPLTPNHFQKPPKAITARTFAILSALVLLLIQPAFAPAAFATFQNAAKTSGPAAAAVGGKLIRTELLSSAWTGFFAGCLHTLSGPDHLAALAPLSIGRTQMESAAVGALWGCGHDAGQVIFGLIFLLLKDRLHIEIIQTWGTRVVGLTLLVIGAMGIKEASEVPILCVALENGECDVSVYESRDSNPVVGKKKIGFATFATGIVHGLEPDALMMVLPALALPSRLAGAAFLIMFLLGTVVAMGSYTVFIGSCSEALKDRVPRITEKLTWASSLVAIALGFAIITSQFFGFSLY*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo