SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma.19g187800

Feature Type:gene_model
Chromosome:Gm19
Start:44594914
stop:44598298
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G36710.1AT Pectin lyase-like superfamily protein JGI N/AIEA
GO:0042545GO-bp cell wall modification EnsemblGenomesN/AIEA
GO:0042545GO-bp cell wall modification JGI N/AIEA
GO:0045490GO-bp pectin catabolic process EnsemblGenomesN/AIEA
GO:0005618GO-cc cell wall EnsemblGenomesN/AIEA
GO:0005618GO-cc cell wall JGI N/AIEA
GO:0016020GO-cc membrane EnsemblGenomesN/AIEA
GO:0016021GO-cc integral component of membrane EnsemblGenomesN/AIEA
GO:0016787GO-mf hydrolase activity EnsemblGenomesN/AIEA
GO:0030599GO-mf pectinesterase activity EnsemblGenomesN/AIEA
GO:0030599GO-mf pectinesterase activity JGI N/AIEA
GO:0045330GO-mf aspartyl esterase activity EnsemblGenomesN/AIEA
PF01095PFAM Pectinesterase JGI N/AIEA
GN7V-46034SoyCyc9-rxn pectinesterase Plant Metabolic Network ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE


View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at SoyMine

Gene information in SoyMine developed by LIS.



View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Corresponding NameAnnotation VersionEvidenceComments
Glyma19g37180 Wm82.a1.v1.1IGC As supplied by JGI


>Glyma.19g187800.1 sequence-type=CDS polypeptide=Glyma.19g187800.1.p locus=Glyma.19g187800 ID=Glyma.19g187800.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGGATTCAACAGAACCCTCTTTTGGCTTTCTGTCTTTGTAATTTTTCTCTTTTCTATCATATTTGTTCTTTATACCACGCCACCTTCCCCCGCTGCCAACACCGCCATTAGTCCTCAAGATAGCTTCAGTTTCCAGATTGGTATATTTAGTAAGATTATAAAGCTTAGTGGCGCTGAACACTTTATGTCTCTGATAACAAGTATAGCTAGGAGGAGACATCATCACCGGAGGAGTCATAAGGAAAAATGTGACAGGTCCAAATGGGATTCCAAGCTTATTCAAGACTATAATGTGAGTCTTGTTCTCACGGTTGACTTAAAGGGCTGTGCTAACTTCAGTAGCGTGCAGAAAGCTGTTGATGCTGTTCCTGAATCTAGTTCTGATACCACCCTTATCATAATCGATTCTGGCACATACAGAGAGAAGGTAGTGGTGCAGGCCAACAAAACAAACTTGATAGTTCAAGGTCAAGGGTATCTGAATACAACCATAGAATGGAACGACACCGCAAATTCCACCGGCGGTACTTCCTATAGCTACTCCTTCGCCGTCTTTGCTTCTAAGTTCACTGCTTACAACATCAGCTTTAAGAACACGGCTCCTCCACCGTCACCAGGAGTTGTTGGGGCACAAGCAGTGGCACTGAGGGTAACCGGTGATCAAGCAGCTTTCTATGGTTGTGGGTTTTATGGTGCGCAGGACACACTCAATGATGATGGTGGGAGACATTATTTTAAAGAATGCTTCATCCAAGGATCCATTGATTTCATATTTGGAAATGCTAGATCACTTTATGAGGATTGTACCATAAACTGTGTAGCAAAAGAAGAGAAGGATGGGATTAGCGGGTCGATCACCGCTCAAGGGAGACAATCGATGAATGAGGAAAGTGGATTTTCCTTTGTGAATTGCAGCATTGTTGGGAGTGGGAGAGTGTGGCTTGGAAGAGCATGGGGAGCCTATGCCACTGTGGTATTCTCAAGAACATACATGTCTGATGTCGTAGCTCCTGATGGATGGAATGATTGGAGAGATCCCTCTAGAGACCAGAGTGTCTTCTTTGGGGAGTACCGTTGTCTTGGACCTGGAGCAAATTATACATCCAGAGTCCCTTATGCCAAGCAACTCAGGGATTACGAAGCAAACTCCTACACGAATATTTCGTACATTGATGGAACTGATTGGCTTCTTGATTATTTTCAAAACTATGTTAACCCTTCATATATCTAA

>Glyma.19g187800.1.p sequence-type=predicted peptide transcript=Glyma.19g187800.1 locus=Glyma.19g187800 ID=Glyma.19g187800.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MGFNRTLFWLSVFVIFLFSIIFVLYTTPPSPAANTAISPQDSFSFQIGIFSKIIKLSGAEHFMSLITSIARRRHHHRRSHKEKCDRSKWDSKLIQDYNVSLVLTVDLKGCANFSSVQKAVDAVPESSSDTTLIIIDSGTYREKVVVQANKTNLIVQGQGYLNTTIEWNDTANSTGGTSYSYSFAVFASKFTAYNISFKNTAPPPSPGVVGAQAVALRVTGDQAAFYGCGFYGAQDTLNDDGGRHYFKECFIQGSIDFIFGNARSLYEDCTINCVAKEEKDGISGSITAQGRQSMNEESGFSFVNCSIVGSGRVWLGRAWGAYATVVFSRTYMSDVVAPDGWNDWRDPSRDQSVFFGEYRCLGPGANYTSRVPYAKQLRDYEANSYTNISYIDGTDWLLDYFQNYVNPSYI*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo