SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma08g45680

Feature Type:gene_model
Chromosome:Gm08
Start:44976686
stop:44977143
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G12850AT Annotation by Michelle Graham. TAIR10: Far-red impaired responsive (FAR1) family protein | chr4:7537065-7537481 FORWARD LENGTH=138 SoyBaseE_val: 3.00E-37ISS
GO:0009639GO-bp Annotation by Michelle Graham. GO Biological Process: response to red or far red light SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF03101PFAM FAR1 DNA-binding domain JGI ISS
UniRef100_Q2HRZ3UniRef Annotation by Michelle Graham. Most informative UniRef hit: FAR1; Polynucleotidyl transferase, Ribonuclease H fold n=1 Tax=Medicago truncatula RepID=Q2HRZ3_MEDTR SoyBaseE_val: 3.00E-66ISS
UniRef100_UPI000233EB2AUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233EB2A related cluster n=1 Tax=unknown RepID=UPI000233EB2A SoyBaseE_val: 1.00E-78ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g342800 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g45680.2   sequence type=CDS   gene model=Glyma08g45680   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATTTTGTGGTAGTGGATTCAGACAACGGAAATGAAGCAGAACATAGCTGTCTAGAAGAGAGTACAAGTATATTTGAAGGAGTTGAAGTTCAAGAACCATATGTGGGCATGGAATTTGATTCTGAAGAAGATGCTAGGGAGATTTGTTGTACGATAATGCAACGGCGACGTTTTGGAATTGATGGGAGGACTCTTGCTCGCCGACTTGGATGTAACAAACAAGGATTCTCACCAAATAACATGGGAATATTAGGACCAGAAAAAAAGCTAAGACCTAGCGCCCGAGAAGGTTGCAAGGCAACAATTTTGGTGAAGTTGGAAAAATCAGGAAAATGGGTTGTCACAAGATTTGTAAAGGATCACAACCATCCTCTAATTGCTACAGCTAATGGGTTCAGCACAGCGGTGAGTTTTCTGCTTGTTTAA

>Glyma08g45680.2   sequence type=predicted peptide   gene model=Glyma08g45680   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDFVVVDSDNGNEAEHSCLEESTSIFEGVEVQEPYVGMEFDSEEDAREICCTIMQRRRFGIDGRTLARRLGCNKQGFSPNNMGILGPEKKLRPSAREGCKATILVKLEKSGKWVVTRFVKDHNHPLIATANGFSTAVSFLLV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo