SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g02390

Feature Type:gene_model
Chromosome:Gm15
Start:1605703
stop:1609778
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g02390
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G16480AT Annotation by Michelle Graham. TAIR10: mitochondrial processing peptidase alpha subunit | chr3:5599906-5602716 FORWARD LENGTH=499 SoyBaseE_val: 0ISS
GO:0006508GO-bp Annotation by Michelle Graham. GO Biological Process: proteolysis SoyBaseN/AISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0009853GO-bp Annotation by Michelle Graham. GO Biological Process: photorespiration SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0080129GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005741GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial outer membrane SoyBaseN/AISS
GO:0005743GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial inner membrane SoyBaseN/AISS
GO:0005750GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial respiratory chain complex III SoyBaseN/AISS
GO:0005758GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial intermembrane space SoyBaseN/AISS
GO:0005759GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial matrix SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009536GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004222GO-mf Annotation by Michelle Graham. GO Molecular Function: metalloendopeptidase activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0046872GO-mf Annotation by Michelle Graham. GO Molecular Function: metal ion binding SoyBaseN/AISS
KOG2067 KOG Mitochondrial processing peptidase, alpha subunit JGI ISS
PTHR11851Panther METALLOPROTEASE JGI ISS
PTHR11851:SF69Panther SUBFAMILY NOT NAMED JGI ISS
PF00675PFAM Insulinase (Peptidase family M16) JGI ISS
PF05193PFAM Peptidase M16 inactive domain JGI ISS
UniRef100_G7LGQ5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Mitochondrial-processing peptidase subunit alpha n=1 Tax=Medicago truncatula RepID=G7LGQ5_MEDTR SoyBaseE_val: 0ISS
UniRef100_UPI000233B2F6UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233B2F6 related cluster n=1 Tax=unknown RepID=UPI000233B2F6 SoyBaseE_val: 0ISS

Expression Patterns of Glyma15g02390
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g02390
ParalogEvidenceComments
Glyma13g43000 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g02390 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g020800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g02390
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g02390
>Glyma15g02390.1   sequence type=CDS   gene model=Glyma15g02390   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTACAGAGCAGTAGCTTCACGTCTCACCCTTCCCAAGGGAAATGGGAGAACCTTGGGAGCCTCCAGAGGTTTATTCAACTGGCTTACTGGGGAATCTTCAAATCCTCTTCCTCCCCTTGACACCCCACTTAGAGGGGTTTCCCTGCCACCTTCATTGCCAGATTATGTTGAACCAAGCAAGACCAAGATCACAACTCTCCCCAATGGTCTAAAAATTGCATCAGAAACCTCACCAAACCCTGCTGCCTCAATTGGGTTATATGTTGACTGTGGTTCCCTCTATGAGACGCCATTGTCAAGCGGGGCGTCACACCTGTTAGAGAAAATGTCTTTCAAGAGCACGGCAAACCGAAGTCACTTTCGTGTTGTAAGGGAAGTGGAAGCAGTTGGTGGCAATGTAGGAGCCTCGGCCTCTCGGGAGCAAATGGGCTACACTTTTGATGCTCTAAAAACTTATGTTCCACAAATGATTGAGTTGCTGGTTGACTGCGTAAGGAACCCGGCCTTCTTAGATTGGGAGGTCAATGAAGAGCTTCGGAAGGTGAAATCAGAACTTGGAGAACTATCAAACAATCCCCAAGGCTTACTTTTGGAGGCAGTTCACTCTGCTGGTTATTCTGGAGCATTGGCTAATCCACTTTTGGCTTCTGAATCAGCACTGAACACATTAAATAGCTCCCTTTTAGAGGAATTTGTTGCTGAGAATTATACTGCATCTAGAATGGTACTTGCAGCATCTGGGGTTGAGCATGAAGAACTTTTATCTGTCGCTGAACCACTTCTCTCTGATCTACCAAGTGTTCCCTGTCCTGAAGAACCAAAATCTGAATATGTTGGTGGAGATTTCCGTCGTCAAGGTGAACCAGGGGTTGCACATGTAGCTATTGCTTTTGAAGTGCCTGGTGGCTGGAAAAAAGAGAAAGAAGCTATTGTTTTGACTGTTCTACAGATGCTTATGGGAGGAGGTGGGTCATTCTCAGCCGGAGGGCCTGGGAAAGGGATGCACTCAAGGCTGTTTCTTCGTGTCTTGAATGAACATCAACAGATTCATTCTTTTTCTGCATTCAACAGTCTCTTCAACAATACAGGGTTATTTGGCATCTATGCAAGCACGGGCTCTGATTTTGTGGCAAAAGCTGTGGATTTAGCAGCCAGAGAATTAATTGCAATTGCATCACCAGGACAAGTTTCACAGGTACAGCTTGACCGTGCTAAGGTATCCACGAAGTCTGCAGTTCTAATGAATTTGGAGTCCAGAATGATTGCATCAGAGGATATAGGAAGGCAGATATTGACTTATGGAGAAAGGAAGCCACTGGAGCAGTTCTTTAAGGCAGTAGATGGAATCACTTTGAATGATATCACTAAAATTTCTCAGAAGATTATTTCCTCACCTCTCACTATGGCATCCTATGGGGATGTATTCAATGTCCCCAGTTACGAATCCGTTAGCAGGAAGTTCCATGCAAAATGA
Predicted protein sequences of Glyma15g02390
>Glyma15g02390.1   sequence type=predicted peptide   gene model=Glyma15g02390   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MYRAVASRLTLPKGNGRTLGASRGLFNWLTGESSNPLPPLDTPLRGVSLPPSLPDYVEPSKTKITTLPNGLKIASETSPNPAASIGLYVDCGSLYETPLSSGASHLLEKMSFKSTANRSHFRVVREVEAVGGNVGASASREQMGYTFDALKTYVPQMIELLVDCVRNPAFLDWEVNEELRKVKSELGELSNNPQGLLLEAVHSAGYSGALANPLLASESALNTLNSSLLEEFVAENYTASRMVLAASGVEHEELLSVAEPLLSDLPSVPCPEEPKSEYVGGDFRRQGEPGVAHVAIAFEVPGGWKKEKEAIVLTVLQMLMGGGGSFSAGGPGKGMHSRLFLRVLNEHQQIHSFSAFNSLFNNTGLFGIYASTGSDFVAKAVDLAARELIAIASPGQVSQVQLDRAKVSTKSAVLMNLESRMIASEDIGRQILTYGERKPLEQFFKAVDGITLNDITKISQKIISSPLTMASYGDVFNVPSYESVSRKFHAK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo