SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Your request returned many database records. A representative example is shown. To see all the results from your search click either of the buttons below to initiate a file download of the results file to your computer.
   
Click here to download a FASTA file of all of the results from your search
Click here to download all of the results from your search as a tab-delimited file suitable for import into a spreadsheet.
   
Element ID   RLG_Gmr449_Gm6-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr449
Description   SOLO
Chromosome   Gm06
Start Position   43836681
End Position   43836945
Sequence   TGTTAGGTTGCTCGCCCTTGTATTCGAGATCAAGGGAATATCCGTTAAGCAAAGAAAGCAAGAAAGAGAGAAGGAGAGAA
TACTGAATATATTTCTACGTGTTTTATTCAATACAAAGGGAATTATTTATAGCCAATGATTGCACTACATGATAACTACT
TCTATCCACTACATGATAACTACTACTATCCACTACATTAACTACTTCTAGAATGATAACTACCCCTATGACAGGTTTCC
ATGGCAGATCATCTTCTTCCTAACA





Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo