Soybean Fast Neutron Mutants; file details

Data for this ~2011 Soybean Fast Neutron project are available at the SoyBase Data Store in the form of tabular and fasta sequence data. Samples from each files are shown first below. Individual files are also linked from the main Fast Neutron project page.

fn_indels.nt.20140304.fasta.gz
Genomic sequence from FN mutation deletions, from the Wm82.a1.v1 / Wm82.gnm1.ann1 assembly 
>EM01.1 Gm09:6094155-6183855    R09C04DSCW08YB_1
GGAAAAGTCCATCCCACAGTGATAGATTTCTACGTACTTCCACTAATGGGGTTGCTGGTAAATTAGAATGCCTCCAAAAT
TACCCACACACAGTTGGATAATATTTATTCCCTTAATCACATCGCAAGACACCAAAAGTCCAATACTTTGAACAAGAACA
ATTTAGATGTACGTGTAACTTCATGGAAAGGACATGTAACTAAGTCGTGCATTTAAGGGAGGAGTCTTCACATTGGGTGT
insertion_event.tsv.gz -- Insertion IDs, names, vectors
insertionID insertionName mutantID soybaseName vectorID vectorName
1 T91301089 1 T91301089 1 Tgm9
2 T91200417 2 T91200417 1 Tgm9
3 T91301132 3 T91301132 1 Tgm9
insertion_mutant.tsv.gz -- Insertion line and responsible lab
mutantID insertionName cultivar originatingLab comments
1 T91301089 T322 Bhattacharyya Lab, Iowa State Univ.
2 T91200417 T322 Bhattacharyya Lab, Iowa State Univ.
3 T91301132 T322 Bhattacharyya Lab, Iowa State Univ.
insertion_mutant_props.tsv.gz -- Phenotypic effects in mutant lines
mutantID mutantName property propertyValue soyNumber
161 MP1JKGA0209.B.02.03.47.17.20.M6 whole plant phenotype early maturing SOY:0001646
162 MP1JKGA0209.B.02.03.47.17.20.M6 whole plant phenotype early maturing SOY:0001646
163 MP1JKGA0209.B.02.03.47.02.03.M6 whole plant phenotype early maturing SOY:0001646
insertion_mutant_synonym.tsv.gz -- Mutant line name synonyms
mutantID mutantName synonym
108 DS9THGHNE8231-770-04 DS9THGHNE8231-770-04
109 DS9THGHNE8238-772-08 DS9THGHNE8238-772-08
110 DS9THGHNE8899-774-03 DS9THGHNE8899-774-03T1-1
insertion_position.tsv.gz -- Insertion positions, Wm82.a2.v1
insertionID insertionName buildVersion chromosome position
1 T91301089 Wm82.a2.v1 Gm01 2794915
2 T91200417 Wm82.a2.v1 Gm01 11607273
3 T91301132 Wm82.a2.v1 Gm01 50063671
mutant_cgh_experiment_genes_table.tsv.gz -- Genes affected by mutations (Wm82.a1.v1)
cgh_id indel_id gene_name copy_number relation_to_indel
EM01 1 Glyma09g07230 0 within
EM01 1 Glyma09g07240 0 within
EM01 1 Glyma09g07250 0 within
mutant_cgh_experiment_indel_table.tsv.gz -- Mutant indel locations (Wm82.a1)
cgh_id indel_id indel_type chromosome_name chromosome_start_bp chromosome_end_bp sample_id chip_name
EM01 1 deletion Gm09 6094155 6183855 R09C04DSCW08YB...1 Nimblegen Soy 700K CGH
EM01 2 deletion Gm10 22383377 22393142 R09C04DSCW08YB...1 Nimblegen Soy 700K CGH
EM01 3 deletion Gm16 31403512 32350348 R09C04DSCW08YB...1 Nimblegen Soy 700K CGH
mutant_cgh_experiment_indel_table_v2.tsv.gz -- Mutant indel locations; new identifiers
cgh_id indel_id indel_type chromosome_name chromosome_start_bp chromosome_end_bp sample_id chip_name
FN0110332.03.M3 1 Homozygous deletion Gm02 22519674 22555063 FN0110332 091113_Gmax_RS_CGH_HX3 (700k);Cy5ref=M92-220
FN0110332.01.M3 1 Homozygous deletion Gm02 27809420 27966363 FN0110332 091113_Gmax_RS_CGH_HX3 (700k);Cy5ref=M92-220 pool
FN0110332.02.02.M4 1 Duplication Gm03 14037899 14040619 FN0110332 110921_Gmax_RS_CGH_UX3(1.4M)DEVA;Cy5ref=M92-220
mutant_cgh_experiment_locus_table.tsv.gz -- SSR markers in indel regions
cgh_id indel_id locus copy_number relation_to_indel
EM01 1 BARC-057313-14690 0 within
EM01 1 BARCSOYSSR_09_0367 0 within
EM01 1 BARCSOYSSR_09_0368 0 within
mutant_descriptor_xref_table.tsv.gz -- SoyBase trait names and IDs
descriptor ontology_term
2 fused main stems SOY:0001389
abnormal fused trifoliate leaf shape SOY:0001389
abnormal leaf shape SOY:0001389
mutant_descriptors_table.tsv.gz -- Mutant phenotype descriptions
sample_id experiment_id descriptor
1R01C57CMN09NSFBV FN1.09 erect growth
1R01C57CMN09NSFBV FN1.09 spindly
1R01C81CMN09NSFBV FN1.09 slightly stunted
mutant_experiment_table.tsv.gz -- Mutation experiments
experiment_id mutagen lab experiment_date reference_id description
FN fast neutron USDA-ARS & UMN: Bolon/Vance 2007/2008 RTN20111229.1 Parent cultivar for mutagenesis.
FN1.01 fast neutron USDA-ARS & UMN: Bolon/Vance 4/2007 RTN20111229.1 Control seeds of M92-220.
FN1.02 fast neutron USDA-ARS & UMN: Bolon/Vance 4/2007 RTN20111229.1 Seeds of M92-220 were mutagenized using fast neutrons.
mutant_files_table.tsv.gz -- Mutants and image names
sample_id filename original_name file_type
1R01C57CMN09NSFBV 1R01C57CMN09NSFBV_1.jpg whole_plant
1R01C81CMN09NSFBV 1R01C81CMN09NSFBV_1.jpg whole_plant
1R02C16CMN09NSFBV 1R02C16CMN09NSFBV_1.jpg whole_plant
mutant_name_translation_table.tsv.gz -- Mutant name correspondences (Soybase ID, sample ID, truncated sample ID)
Soybase_ID Sample_ID Truncated_ID
FN0110101 1R01C01CMN09NSFBV 1R01C01CMN09
FN0110103 1R01C03CMN09NSFBV 1R01C03CMN09
FN0110104 1R01C04CMN09NSFBV 1R01C04CMN09
mutant_samples_table.tsv.gz -- Experiment sample IDs, seed availability, cultivar names
sample_id m2_id generation sample_pedigree experiment_id seeds_available genus species cultivar
1R01C01CMN09NSFBV 1R01C01CMN09NSFBV M2 FN1.09 Unknown Glycine max M92-220
1R01C03CMN09NSFBV 1R01C03CMN09NSFBV M2 FN1.09 Yes Glycine max M92-220
1R01C04CMN09NSFBV 1R01C04CMN09NSFBV M2 FN1.09 Yes Glycine max M92-220
mutant_trait_values_table.tsv.gz -- Mutation IDs and traits
sample_id trait method experiment_id value
1R01C01CMN09NSFBV Ash NIR,DM FN1.09 5.4
1R01C01CMN09NSFBV Fiber NIR,DM FN1.09 5.58
1R01C01CMN09NSFBV Linoleic NIR,DM FN1.09 53.04
Back to the main Fast Neutron project page.