Soybean Fast Neutron Mutants; file details
Data for this ~2011 Soybean Fast Neutron project are available at the
SoyBase Data Store
in the form of tabular and fasta sequence data.
Samples from each files are shown first below.
Individual files are also linked from the main Fast Neutron project page.
fn_indels.nt.20140304.fasta.gz
Genomic sequence from FN mutation deletions, from the Wm82.a1.v1 / Wm82.gnm1.ann1 assembly
>EM01.1 Gm09:6094155-6183855 R09C04DSCW08YB_1
GGAAAAGTCCATCCCACAGTGATAGATTTCTACGTACTTCCACTAATGGGGTTGCTGGTAAATTAGAATGCCTCCAAAAT
TACCCACACACAGTTGGATAATATTTATTCCCTTAATCACATCGCAAGACACCAAAAGTCCAATACTTTGAACAAGAACA
ATTTAGATGTACGTGTAACTTCATGGAAAGGACATGTAACTAAGTCGTGCATTTAAGGGAGGAGTCTTCACATTGGGTGT
insertion_event.tsv.gz --
Insertion IDs, names, vectors
insertionID | |
insertionName | |
mutantID | |
soybaseName | |
vectorID | |
vectorName | |
1 | T91301089 | 1 | T91301089 | 1 | Tgm9 |
2 | T91200417 | 2 | T91200417 | 1 | Tgm9 |
3 | T91301132 | 3 | T91301132 | 1 | Tgm9 |
insertion_mutant.tsv.gz --
Insertion line and responsible lab
mutantID | |
insertionName | |
cultivar | |
originatingLab | |
comments | |
1 | T91301089 | T322 | Bhattacharyya Lab, Iowa State Univ. | |
2 | T91200417 | T322 | Bhattacharyya Lab, Iowa State Univ. | |
3 | T91301132 | T322 | Bhattacharyya Lab, Iowa State Univ. | |
insertion_mutant_props.tsv.gz --
Phenotypic effects in mutant lines
mutantID | |
mutantName | |
property | |
propertyValue | |
soyNumber | |
161 | MP1JKGA0209.B.02.03.47.17.20.M6 | whole plant phenotype | early maturing | SOY:0001646 |
162 | MP1JKGA0209.B.02.03.47.17.20.M6 | whole plant phenotype | early maturing | SOY:0001646 |
163 | MP1JKGA0209.B.02.03.47.02.03.M6 | whole plant phenotype | early maturing | SOY:0001646 |
insertion_mutant_synonym.tsv.gz --
Mutant line name synonyms
mutantID | |
mutantName | |
synonym | |
108 | DS9THGHNE8231-770-04 | DS9THGHNE8231-770-04 |
109 | DS9THGHNE8238-772-08 | DS9THGHNE8238-772-08 |
110 | DS9THGHNE8899-774-03 | DS9THGHNE8899-774-03T1-1 |
insertion_position.tsv.gz --
Insertion positions, Wm82.a2.v1
insertionID | |
insertionName | |
buildVersion | |
chromosome | |
position | |
1 | T91301089 | Wm82.a2.v1 | Gm01 | 2794915 |
2 | T91200417 | Wm82.a2.v1 | Gm01 | 11607273 |
3 | T91301132 | Wm82.a2.v1 | Gm01 | 50063671 |
mutant_cgh_experiment_genes_table.tsv.gz --
Genes affected by mutations (Wm82.a1.v1)
cgh_id | |
indel_id | |
gene_name | |
copy_number | |
relation_to_indel | |
EM01 | 1 | Glyma09g07230 | 0 | within |
EM01 | 1 | Glyma09g07240 | 0 | within |
EM01 | 1 | Glyma09g07250 | 0 | within |
mutant_cgh_experiment_indel_table.tsv.gz --
Mutant indel locations (Wm82.a1)
cgh_id | |
indel_id | |
indel_type | |
chromosome_name | |
chromosome_start_bp | |
chromosome_end_bp | |
sample_id | |
chip_name | |
EM01 | 1 | deletion | Gm09 | 6094155 | 6183855 | R09C04DSCW08YB...1 | Nimblegen Soy 700K CGH |
EM01 | 2 | deletion | Gm10 | 22383377 | 22393142 | R09C04DSCW08YB...1 | Nimblegen Soy 700K CGH |
EM01 | 3 | deletion | Gm16 | 31403512 | 32350348 | R09C04DSCW08YB...1 | Nimblegen Soy 700K CGH |
mutant_cgh_experiment_indel_table_v2.tsv.gz --
Mutant indel locations; new identifiers
cgh_id | |
indel_id | |
indel_type | |
chromosome_name | |
chromosome_start_bp | |
chromosome_end_bp | |
sample_id | |
chip_name | |
FN0110332.03.M3 | 1 | Homozygous deletion | Gm02 | 22519674 | 22555063 | FN0110332 | 091113_Gmax_RS_CGH_HX3 (700k);Cy5ref=M92-220 |
FN0110332.01.M3 | 1 | Homozygous deletion | Gm02 | 27809420 | 27966363 | FN0110332 | 091113_Gmax_RS_CGH_HX3 (700k);Cy5ref=M92-220 pool |
FN0110332.02.02.M4 | 1 | Duplication | Gm03 | 14037899 | 14040619 | FN0110332 | 110921_Gmax_RS_CGH_UX3(1.4M)DEVA;Cy5ref=M92-220 |
mutant_cgh_experiment_locus_table.tsv.gz --
SSR markers in indel regions
cgh_id | |
indel_id | |
locus | |
copy_number | |
relation_to_indel | |
EM01 | 1 | BARC-057313-14690 | 0 | within |
EM01 | 1 | BARCSOYSSR_09_0367 | 0 | within |
EM01 | 1 | BARCSOYSSR_09_0368 | 0 | within |
mutant_descriptor_xref_table.tsv.gz --
SoyBase trait names and IDs
descriptor | |
ontology_term | |
2 fused main stems | SOY:0001389 |
abnormal fused trifoliate leaf shape | SOY:0001389 |
abnormal leaf shape | SOY:0001389 |
mutant_descriptors_table.tsv.gz --
Mutant phenotype descriptions
sample_id | |
experiment_id | |
descriptor | |
1R01C57CMN09NSFBV | FN1.09 | erect growth |
1R01C57CMN09NSFBV | FN1.09 | spindly |
1R01C81CMN09NSFBV | FN1.09 | slightly stunted |
mutant_experiment_table.tsv.gz --
Mutation experiments
experiment_id | |
mutagen | |
lab | |
experiment_date | |
reference_id | |
description | |
FN | fast neutron | USDA-ARS & UMN: Bolon/Vance | 2007/2008 | RTN20111229.1 | Parent cultivar for mutagenesis. |
FN1.01 | fast neutron | USDA-ARS & UMN: Bolon/Vance | 4/2007 | RTN20111229.1 | Control seeds of M92-220. |
FN1.02 | fast neutron | USDA-ARS & UMN: Bolon/Vance | 4/2007 | RTN20111229.1 | Seeds of M92-220 were mutagenized using fast neutrons. |
mutant_files_table.tsv.gz --
Mutants and image names
sample_id | |
filename | |
original_name | |
file_type | |
1R01C57CMN09NSFBV | 1R01C57CMN09NSFBV_1.jpg | | whole_plant |
1R01C81CMN09NSFBV | 1R01C81CMN09NSFBV_1.jpg | | whole_plant |
1R02C16CMN09NSFBV | 1R02C16CMN09NSFBV_1.jpg | | whole_plant |
mutant_name_translation_table.tsv.gz --
Mutant name correspondences (Soybase ID, sample ID, truncated sample ID)
Soybase_ID | |
Sample_ID | |
Truncated_ID | |
FN0110101 | 1R01C01CMN09NSFBV | 1R01C01CMN09 |
FN0110103 | 1R01C03CMN09NSFBV | 1R01C03CMN09 |
FN0110104 | 1R01C04CMN09NSFBV | 1R01C04CMN09 |
mutant_samples_table.tsv.gz --
Experiment sample IDs, seed availability, cultivar names
sample_id | |
m2_id | |
generation | |
sample_pedigree | |
experiment_id | |
seeds_available | |
genus | |
species | |
cultivar | |
1R01C01CMN09NSFBV | 1R01C01CMN09NSFBV | M2 | | FN1.09 | Unknown | Glycine | max | M92-220 |
1R01C03CMN09NSFBV | 1R01C03CMN09NSFBV | M2 | | FN1.09 | Yes | Glycine | max | M92-220 |
1R01C04CMN09NSFBV | 1R01C04CMN09NSFBV | M2 | | FN1.09 | Yes | Glycine | max | M92-220 |
mutant_trait_values_table.tsv.gz --
Mutation IDs and traits
sample_id | |
trait | |
method | |
experiment_id | |
value | |
1R01C01CMN09NSFBV | Ash | NIR,DM | FN1.09 | 5.4 |
1R01C01CMN09NSFBV | Fiber | NIR,DM | FN1.09 | 5.58 |
1R01C01CMN09NSFBV | Linoleic | NIR,DM | FN1.09 | 53.04 |
Back to the
main Fast Neutron project page.