SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma01g05440

Feature Type:gene_model
Chromosome:Gm01
Start:5263625
stop:5268235
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma01g05440
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G05290AT Annotation by Michelle Graham. TAIR10: peroxisomal adenine nucleotide carrier 1 | chr3:1506129-1507614 REVERSE LENGTH=322 SoyBaseE_val: 3.00E-169ISS
GO:0006635GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation SoyBaseN/AISS
GO:0006810GO-bp Annotation by Michelle Graham. GO Biological Process: transport SoyBaseN/AISS
GO:0006839GO-bp Annotation by Michelle Graham. GO Biological Process: mitochondrial transport SoyBaseN/AISS
GO:0007031GO-bp Annotation by Michelle Graham. GO Biological Process: peroxisome organization SoyBaseN/AISS
GO:0009407GO-bp Annotation by Michelle Graham. GO Biological Process: toxin catabolic process SoyBaseN/AISS
GO:0015866GO-bp Annotation by Michelle Graham. GO Biological Process: ADP transport SoyBaseN/AISS
GO:0015867GO-bp Annotation by Michelle Graham. GO Biological Process: ATP transport SoyBaseN/AISS
GO:0043161GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0080024GO-bp Annotation by Michelle Graham. GO Biological Process: indolebutyric acid metabolic process SoyBaseN/AISS
GO:0080129GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly SoyBaseN/AISS
GO:0090351GO-bp Annotation by Michelle Graham. GO Biological Process: seedling development SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005743GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial inner membrane SoyBaseN/AISS
GO:0005777GO-cc Annotation by Michelle Graham. GO Cellular Compartment: peroxisome SoyBaseN/AISS
GO:0005347GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP transmembrane transporter activity SoyBaseN/AISS
GO:0015217GO-mf Annotation by Michelle Graham. GO Molecular Function: ADP transmembrane transporter activity SoyBaseN/AISS
KOG0769 KOG Predicted mitochondrial carrier protein JGI ISS
PTHR24089Panther FAMILY NOT NAMED JGI ISS
PTHR24089:SF36Panther SUBFAMILY NOT NAMED JGI ISS
PF00153PFAM Mitochondrial carrier protein JGI ISS
UniRef100_B6ZJZ9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Peroxisomal adenine nucleotide carrier 1 n=1 Tax=Glycine max RepID=B6ZJZ9_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1J5P2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J5P2_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma01g05440
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma01g05440
ParalogEvidenceComments
Glyma02g11800 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma01g05440 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g045800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma01g05440
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma01g05440
>Glyma01g05440.1   sequence type=CDS   gene model=Glyma01g05440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAACTATGACCCTTCTTTGTCTCGTAATCTTGGGTTCCAAAAGAAGGAGAAGATGAACGTGGATCTGGAATCATTGGCAGAGGCAACTTCTGGGGCCATAGGATCACTGATCAGCACCACTATTCTCTACCCACTTGACACCTGCAAGACCAAGTACCAGGCTGAGGCTCGTTCCTCAGGTCGAATAAAATACAGGAATCTCACTGATGTATTATTGGAGGCAATATCTAACCGTCAGGTGCTTTCACTTTACCAGGGCCTTGGAACAAAGAATCTTCAATCCTTCATTTCACAATTTGTCTACTTCTATGGATACAGCTATTTTAAAAGGCTGTATCTAGAAAAAAGCGGTTATAAATCCATTGGAACAAAAGCAAACTTGGTTATTGCTGCTGCTGCTGGGGCTTGCACAGCCATTGCGACTCAGCCCCTGGATACAGCCTCTTCAAGGATGCAGACAAGTGAATTTGGAAAGTCTAAAGGGCTACTGAAGACCCTTACAGAAGGAACCTGGAGTGATGCATTTGATGGCCTCGGTATTTCCTTGCTGCTGACATCAAACCCTGCAATTCAGTATACGGTGTTTGATCAGCTGAAGCAACGAGCACTGAAGAATAAACAAAACAATGCTGATAAAGGAACATCTCCAGCATCCCTTTCCGCATTTATGGCCTTTCTTTTAGGTGCAATTTCAAAGAGCATTGCTACCTGTCTAACATATCCAGCTATCAGGTGCAAAGTTATCATTCAAGCTGCAGACTCGGCTGAACCAACCTCCAAAACAATGATAAAATCACAGAAAACAGTGTCTAGTGTTCTCTATGGAATATGGAAAAGGGAGGGCTTACTGGGATATTTCAAAGGATTGCATGCTCAGATCTTAAAAACTGTTTTGAGCTCAGCACTGCTCTTAATGATCAAGGAAAAGATCTCTGCTACTACCTGGGTGCTTATCCTTGCACTTAAAAGGTACCTATTACTTCCAAGGGGTAGGATTAAGAACTTGTAA
Predicted protein sequences of Glyma01g05440
>Glyma01g05440.1   sequence type=predicted peptide   gene model=Glyma01g05440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNYDPSLSRNLGFQKKEKMNVDLESLAEATSGAIGSLISTTILYPLDTCKTKYQAEARSSGRIKYRNLTDVLLEAISNRQVLSLYQGLGTKNLQSFISQFVYFYGYSYFKRLYLEKSGYKSIGTKANLVIAAAAGACTAIATQPLDTASSRMQTSEFGKSKGLLKTLTEGTWSDAFDGLGISLLLTSNPAIQYTVFDQLKQRALKNKQNNADKGTSPASLSAFMAFLLGAISKSIATCLTYPAIRCKVIIQAADSAEPTSKTMIKSQKTVSSVLYGIWKREGLLGYFKGLHAQILKTVLSSALLLMIKEKISATTWVLILALKRYLLLPRGRIKNL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo