SoyBase NEW SoyBase for review!
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma03g01540

Feature Type:gene_model
Chromosome:Gm03
Start:1330203
stop:1333289
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G61250AT Annotation by Michelle Graham. TAIR10: myb domain protein 17 | chr3:22671306-22672551 FORWARD LENGTH=299 SoyBaseE_val: 6.00E-120ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009751GO-bp Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0048443GO-bp Annotation by Michelle Graham. GO Biological Process: stamen development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
KOG0048 KOG Transcription factor, Myb superfamily JGI ISS
PTHR10641Panther MYB-RELATED JGI ISS
PF00249PFAM Myb-like DNA-binding domain JGI ISS
UniRef100_G7KQ33UniRef Annotation by Michelle Graham. Most informative UniRef hit: Myb-like transcription factor n=1 Tax=Medicago truncatula RepID=G7KQ33_MEDTR SoyBaseE_val: 8.00E-126ISS
UniRef100_I1JKB2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1JKB2_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma07g07960 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g013300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma03g01540.1   sequence type=CDS   gene model=Glyma03g01540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAAGGAAACCATGTTGTGACAAGATGGGGTTGAAGAAAGGTCCTTGGACTGCTGAAGAGGATGAGATTCTTGTAAATTATATCAACAAGAATGGTGGTCATGGAAGTTGGCGTTCTCTCCCCAATTTAGCAGGTCTTCTTCGTTGTGGTAAGAGTTGCCGGTTAAGATGGACAAACTACCTCAGACCAGATATTAAACGTGGTTCCTTTACACTTGAGGATGAAAAACTAATCATACAGCTTCATGGTATCCTTGGAAATAGGTGGGCTGCTATAGCCTCTCAGCTACCAGGAAGAACAGACAATGAGATAAAAAACTTATGGAACACCCACTTGAAGAAACGTCTCATTTGCATGGGCCTTGACCCACAAACCCACCAACCACTAGCCTCTCCACATAACCCTAATGACAAGGCTCATGCATCATCATCCACTTCAACCCGCCACATGGCCCAGTGGGAGAGTGCAAGGCTTGAAGCAGAGGCAAGGCTCTCAAGGGAACCACACTTATACTACAACAACAACAAAACTGACTCTGACTACTTCCTACGAATTTGGAACTCTGATCTTGGAGAATCTTTTCGTGATGTCCACAAATTAGAATCTTCAATCAAATGTGAGTCACAGTCTGCCACAACGGATTTGGCTTCCTTAACCCCAGCAAGCATTGTGAAAGAGGAGTTTCTGTGGGGTGTTAAGAAAATTGTCTCGGATTCATCATCAAGCTCTAGTGAACTACACCATGACTCTTGTGACACTTCTTTGCAGCTCTTGTTAGACTTTCCTATGAACAATGACATGAGCTTCTTAGAATTATGA

>Glyma03g01540.1   sequence type=predicted peptide   gene model=Glyma03g01540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGRKPCCDKMGLKKGPWTAEEDEILVNYINKNGGHGSWRSLPNLAGLLRCGKSCRLRWTNYLRPDIKRGSFTLEDEKLIIQLHGILGNRWAAIASQLPGRTDNEIKNLWNTHLKKRLICMGLDPQTHQPLASPHNPNDKAHASSSTSTRHMAQWESARLEAEARLSREPHLYYNNNKTDSDYFLRIWNSDLGESFRDVHKLESSIKCESQSATTDLASLTPASIVKEEFLWGVKKIVSDSSSSSSELHHDSCDTSLQLLLDFPMNNDMSFLEL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo