SoyBase NEW SoyBase for review!
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma03g05180

Feature Type:gene_model
Chromosome:Gm03
Start:5448255
stop:5451114
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G19640AT Annotation by Michelle Graham. TAIR10: jasmonic acid carboxyl methyltransferase | chr1:6789166-6791708 REVERSE LENGTH=389 SoyBaseE_val: 1.00E-88ISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009620GO-bp Annotation by Michelle Graham. GO Biological Process: response to fungus SoyBaseN/AISS
GO:0009694GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid metabolic process SoyBaseN/AISS
GO:0009695GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0008168GO-mf Annotation by Michelle Graham. GO Molecular Function: methyltransferase activity SoyBaseN/AISS
GO:0030795GO-mf Annotation by Michelle Graham. GO Molecular Function: jasmonate O-methyltransferase activity SoyBaseN/AISS
PF03492PFAM SAM dependent carboxyl methyltransferase JGI ISS
UniRef100_G7KYA2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Jasmonate O-methyltransferase n=2 Tax=Medicago truncatula RepID=G7KYA2_MEDTR SoyBaseE_val: 7.00E-172ISS
UniRef100_I1JL27UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1JL27_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g042300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma03g05180.2   sequence type=CDS   gene model=Glyma03g05180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCAACTAATTATTTAATGGCAACAGAGCGAGTGCTTCACATGAAGGATGGCTTGAGAGAAACAAGCTATGCAAAAAACTCCTTACTTCAGAGAAAAGTGGCAATGAAAGTGAAAATCATACTTGAAGAGAATGTGAAGCGGATGATGTCCAACATAAATATTGAAAGCTGCTGTAAGATAGCAGATTTAGGTTGTTCTTCAGGACCCAATGCACTGATAACTATGTCAAATATCTTGAACATCATGTATAATGCTAGCCTGAGCTTAAACAAGCGTGTGCCACGTGTATTCCAAATTTACCTCAATGATCTATTCGGAAATGATTTCAATTCCATCATCAAATTAATTCCAGACTTCTACCAAAGTATACATCAAGAAAAAAGAGGCAATTTTGGAACATGCTTTATTCATGCAACACCGGGGAGCTTTTATGGGAGGCTTTTTCCTGATAATTACATCCACTTCTTTCATTCTTCTTACAGTCTCCATTGGCTATCTCAGGCACCAAAAACTTCGAGCAACATAGCTATACCACTCAACAAGGGAAATGTTTATATAACAAGTACAAGCTCTTCTTCAGTCTATGAAGCATACTTCAAGCAATTTGAAAAGGATTTCAAACTTTTTCTAAAGTCACGCTCGGAGGAACTAAGATCGGGTGGTATTATGGTACTTACTTTCATTGGCAGAGATAAAACTCGAAAAATTAATAATCCTGCAGAGGTAATTGGTATGGTACTCAACGGTATGGTCCAAGAGGGTCTGGTTGAAGAGGAAAAATTGGACTTCTTTGATTTACCTATATATGGTCCTACAGCAGAAGAAGTTGGACAAGTGATTGAAAGAGAAGGATCTTTTACCCTTCAAACATTAAAAACTATCAAAATAGGTTGGGATGCAAACCTTGAAGAGGAAGTTGATGATGGTATTCTTGATAGCAAAATAAGAGGGGAGTTTATAGCTAAGTCTATCAGAGCTGTTTTGGAACCTATCTTGTCAGCTGAGTTTAGCGAAGATATCATGGATGAGTTGTTCTCAAGATACGCAACTCTGGTTGCCCAACTCATTGAGGTGGAGACGTTGGAGTATACTAATGTAGTAGTCACCTTGACCAAACATTCTTGA

>Glyma03g05180.2   sequence type=predicted peptide   gene model=Glyma03g05180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSTNYLMATERVLHMKDGLRETSYAKNSLLQRKVAMKVKIILEENVKRMMSNINIESCCKIADLGCSSGPNALITMSNILNIMYNASLSLNKRVPRVFQIYLNDLFGNDFNSIIKLIPDFYQSIHQEKRGNFGTCFIHATPGSFYGRLFPDNYIHFFHSSYSLHWLSQAPKTSSNIAIPLNKGNVYITSTSSSSVYEAYFKQFEKDFKLFLKSRSEELRSGGIMVLTFIGRDKTRKINNPAEVIGMVLNGMVQEGLVEEEKLDFFDLPIYGPTAEEVGQVIEREGSFTLQTLKTIKIGWDANLEEEVDDGILDSKIRGEFIAKSIRAVLEPILSAEFSEDIMDELFSRYATLVAQLIEVETLEYTNVVVTLTKHS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo