Report for Sequence Feature Glyma08g21650
Feature Type: gene_model
Chromosome: Gm08
Start: 16490682
stop: 16492106
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma08g21650
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G11590 AT
Annotation by Michelle Graham. TAIR10: Integrase-type DNA-binding superfamily protein | chr5:3727789-3728499 REVERSE LENGTH=236
SoyBase E_val: 8.00E-58 ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0045893 GO-bp
Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003677 GO-mf
Annotation by Michelle Graham. GO Molecular Function: DNA binding
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
GO:0043565 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding
SoyBase N/A ISS
PF00847 PFAM
AP2 domain
JGI ISS
UniRef100_B4UW60 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: DREB-like protein n=1 Tax=Arachis hypogaea RepID=B4UW60_ARAHY
SoyBase E_val: 2.00E-68 ISS
UniRef100_I1KV37 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KV37_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma08g21650
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma08g21650
Paralog Evidence Comments
Glyma07g02001 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma08g21650 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.08g202300 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma08g21650
Coding sequences of Glyma08g21650
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma08g21650.1 sequence type=CDS gene model=Glyma08g21650 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGTGCCTGGGGCTCCAAGAAACCAAAAACATTCCCACCATTCTTAACTTCACTCACTTACAAATCACAATGACACAACAAGCAACAACCTCTTCCGAAACAACAACTTCCTCTTCTTCTTCTTCTTCCTCCTCCTCCTCCACATTTTCACCCTCGCAGCATTCGGGCCCAAAGGCCCAGGCCCAGAAACAGAGCAAGAGGCCCAGGGACTGCAGCAAGCACCCGGTGTACCACGGCGTGCGGAAGCGCAACTGGGGCAAATGGGTGTCCGAAATCCGCGAGCCACGCAAGAAGTCCCGAATCTGGCTCGGAACATTCGCCACTCCTGAAATGGCGGCGCGAGCCCACGACGTGGCGGCTCTCACCATCAAGGGCGAGTCAGCAATCCTCAATTTCCCCGAAATTGCGGACCTGCTCCCCAGGCCCGTCACGTGCGCTCCACGTGACATCCAGGCTGCGGCCACGGCCGCGGCCTCCATGGTTAAATTCGACCCCGTGACGCAATCCTCGGACTCGGAGACTCCGGAGTCTTCGGAGCTGAGCGAGATTGTTGAACTTCCCAACATTGAAGACAGCAGCTTTGACTCCGTTGACTCCAGACCGGAGTTCGTGTTGGTCGATGTTGTTGACGGTTGGGTGTTTCCGCCAATGGGAATGGGGTCAGAGGGAATCGAGATCTGTGCCGCTTTTTCTGATGAGTTGTTTCCGCAACAGAGTTTTGTTGATGAGATAGAGATACTACCCATTTGGGATTGA
Predicted protein sequences of Glyma08g21650
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma08g21650.1 sequence type=predicted peptide gene model=Glyma08g21650 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MCLGLQETKNIPTILNFTHLQITMTQQATTSSETTTSSSSSSSSSSSTFSPSQHSGPKAQAQKQSKRPRDCSKHPVYHGVRKRNWGKWVSEIREPRKKSRIWLGTFATPEMAARAHDVAALTIKGESAILNFPEIADLLPRPVTCAPRDIQAAATAAASMVKFDPVTQSSDSETPESSELSEIVELPNIEDSSFDSVDSRPEFVLVDVVDGWVFPPMGMGSEGIEICAAFSDELFPQQSFVDEIEILPIWD*
SoyBase
NEW SoyBase for review!
