SoyBase NEW SoyBase for review!
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g07260

Feature Type:gene_model
Chromosome:Gm10
Start:5971138
stop:5973476
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g07260
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G03560AT Annotation by Michelle Graham. TAIR10: Tetratricopeptide repeat (TPR)-like superfamily protein | chr5:900673-902719 REVERSE LENGTH=241 SoyBaseE_val: 4.00E-93ISS
GO:0015931GO-bp Annotation by Michelle Graham. GO Biological Process: nucleobase-containing compound transport SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0015391GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleobase:cation symporter activity SoyBaseN/AISS
PF09350PFAM Domain of unknown function (DUF1992) JGI ISS
UniRef100_G7IA78UniRef Annotation by Michelle Graham. Most informative UniRef hit: DnaJ homolog subfamily C member n=1 Tax=Medicago truncatula RepID=G7IA78_MEDTR SoyBaseE_val: 5.00E-105ISS
UniRef100_I1L947UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L947_SOYBN SoyBaseE_val: 1.00E-155ISS

Expression Patterns of Glyma10g07260
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g07260
ParalogEvidenceComments
Glyma13g21170 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g07260 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g063500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g07260
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g07260
>Glyma10g07260.1   sequence type=CDS   gene model=Glyma10g07260   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGACGTGTCTTCGCCTTGGGAGATTTACGACTATTGATTCGCTCTCTCTCTTCGTTTCCACCGCTAGATTCTCCTTTTCTTCATCATCTTCGTCGTCGTCCTCGTCGTCATCTTCCGGTAAGTCCAAGACGGGGAAGAAGCTGATGGATCGTCTTTCCACCGTTATCGACGCCGTCAATGATCGCAAACTACCTCCTGAGCTACGTGGCCAGCGCAGCAATGTCAGGTCAGAAACTGACATTATCAACGTTGTTGAGCAAAGAATATGGCATACCATGGAAGAAGGGAAGTTTGAGAATTTGCCAGGCAAAGGCAAGCCGCTTAAGCTCGACACAAATCCTCATGCAGATCCAGCTGAAGACACCCTGTACCGTATCCTGTCAAAAAACGGATATGCACCGGAGTGGGTTGAACTTAACAAAGAGATTAGATCTAAAATATCTGAATGGAGGAAGTCCTTGAAGAAAGCTTGGGCTACTAAGTGCAGTGGAGATCACTCTGAGTGGGTTGAAAGTTCAGAGGCTTTGAAATCTCAGTTACGAGAAATCAATGATAAGGTTTTCCGTTATAACCTTATTGTGCCTTTTGGTCGGCAAATGTTTGGCCTTAAGTGGGAGAAAGAGCTAGGTTACTTAGAAGAAAAATGA
Predicted protein sequences of Glyma10g07260
>Glyma10g07260.1   sequence type=predicted peptide   gene model=Glyma10g07260   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATCLRLGRFTTIDSLSLFVSTARFSFSSSSSSSSSSSSSGKSKTGKKLMDRLSTVIDAVNDRKLPPELRGQRSNVRSETDIINVVEQRIWHTMEEGKFENLPGKGKPLKLDTNPHADPAEDTLYRILSKNGYAPEWVELNKEIRSKISEWRKSLKKAWATKCSGDHSEWVESSEALKSQLREINDKVFRYNLIVPFGRQMFGLKWEKELGYLEEK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo