SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g24121

Feature Type:gene_model
Chromosome:Gm13
Start:27442064
stop:27447350
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g24121
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G18470AT Annotation by Michelle Graham. TAIR10: negative regulator of systemic acquired resistance (SNI1) | chr4:10192984-10195511 FORWARD LENGTH=432 SoyBaseE_val: 3.00E-96ISS
GO:0000085GO-bp Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle SoyBaseN/AISS
GO:0000724GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination SoyBaseN/AISS
GO:0006260GO-bp Annotation by Michelle Graham. GO Biological Process: DNA replication SoyBaseN/AISS
GO:0006261GO-bp Annotation by Michelle Graham. GO Biological Process: DNA-dependent DNA replication SoyBaseN/AISS
GO:0006270GO-bp Annotation by Michelle Graham. GO Biological Process: DNA replication initiation SoyBaseN/AISS
GO:0006275GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication SoyBaseN/AISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0006342GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007129GO-bp Annotation by Michelle Graham. GO Biological Process: synapsis SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0007140GO-bp Annotation by Michelle Graham. GO Biological Process: male meiosis SoyBaseN/AISS
GO:0008283GO-bp Annotation by Michelle Graham. GO Biological Process: cell proliferation SoyBaseN/AISS
GO:0009555GO-bp Annotation by Michelle Graham. GO Biological Process: pollen development SoyBaseN/AISS
GO:0009627GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0010113GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of systemic acquired resistance SoyBaseN/AISS
GO:0010332GO-bp Annotation by Michelle Graham. GO Biological Process: response to gamma radiation SoyBaseN/AISS
GO:0016444GO-bp Annotation by Michelle Graham. GO Biological Process: somatic cell DNA recombination SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016570GO-bp Annotation by Michelle Graham. GO Biological Process: histone modification SoyBaseN/AISS
GO:0016571GO-bp Annotation by Michelle Graham. GO Biological Process: histone methylation SoyBaseN/AISS
GO:0016572GO-bp Annotation by Michelle Graham. GO Biological Process: histone phosphorylation SoyBaseN/AISS
GO:0016579GO-bp Annotation by Michelle Graham. GO Biological Process: protein deubiquitination SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0031047GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA SoyBaseN/AISS
GO:0032204GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of telomere maintenance SoyBaseN/AISS
GO:0032504GO-bp Annotation by Michelle Graham. GO Biological Process: multicellular organism reproduction SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0042138GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation SoyBaseN/AISS
GO:0043247GO-bp Annotation by Michelle Graham. GO Biological Process: telomere maintenance in response to DNA damage SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045132GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation SoyBaseN/AISS
GO:0045892GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048449GO-bp Annotation by Michelle Graham. GO Biological Process: floral organ formation SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0051726GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0044212GO-mf Annotation by Michelle Graham. GO Molecular Function: transcription regulatory region DNA binding SoyBaseN/AISS
UniRef100_Q0ZFU8UniRef Annotation by Michelle Graham. Best UniRef hit: SNI1 n=1 Tax=Glycine max RepID=Q0ZFU8_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q0ZFU8UniRef Annotation by Michelle Graham. Most informative UniRef hit: SNI1 n=1 Tax=Glycine max RepID=Q0ZFU8_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma13g24121
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g24121 not represented in the dataset
Glyma13g24121 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g24121
ParalogEvidenceComments
Glyma07g32461 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g24121 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g172400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g24121
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g24121
>Glyma13g24121.1   sequence type=CDS   gene model=Glyma13g24121   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGAACCCTAGCAGTGGTGAAAGATGGAGCAGAGCAGGAATCGATGACAACATGCTGGCTATGTTTGATGCCTCCGAAACCAAGGATGTTCATCAAGATGCCCTAGATGACCGGATTGCTTTTATTGATGCTGTTCGTGCTTCTTGTGAACATGGAAAACCGCCCACTTCAAAGATTTTTGGGGCAGTTTTCCACATGCTGAGGACAGGGAAGTCTCTAGAGTTGATTGTGGGAAGTTATAAGCTTCTGGTTGATTTAGACAAGCACTTCCCTCGTGTGTATTTATCTGGCATGGATGATTCCCGATCATCATCTAACTCTCCATCAAAATTGGTTGTGGTTAAAGAGGCATGGGCTCCCATTATTGGTTTCGTGGATAAGGCCACTGCTGTTAGTGAAGCCGGTGACAAACAGTCTGGTGGATCTCTTGACCACTCTAGCTTTCAAGCTCTGATTGAAGAGCTGGCTGAAATTTTATCTGAGACCAAATTTGAAGCAGCAAGCATGGAGCCCTTGAGGAACATGTTAATCTTTCAGTACCTTGTCGTTGTTTTTGAGGATGATTTTCTACCTCGCAACGCAACCTTGAACTGGAGCATGCAGAGGGAGTCTTTGCTCAGCCTGCTACTGGGATCTAGGAAAATAAATTACAAAAGCTTGATGAAGTATTTCATGGCAATTCTGTGTCAACTATCTCAACTTCAAAGTGAACTCAGTAAACATCCAGTGCTTCAAGAAAGTTCTGAATCTAAGTTATCCAAAAATTGTCATACTGCACTATCTCTTGCTTTACATGGAGTATTAAAGGACACATGTGTCTCAATGGAGAAACTTCTAGTGATGATTATGGACCTTGATATGGCAAGGAAGATAGCAGATATTGAAGGTCACACTACAAGAGGAGACAGTCCAAGAACACCTTTGATGGACATAATTCTGGATGAACTCTCTTACAACAAAGATAGTGTCCCTGTTTTTCTTAAGATCTTCAGTGAATCTAAATGGAAGCTAGAAATAGTTGTGCAGTATCTGTGGAAATACATAACCAAGCCTTCTGTTCGTACCCGCAAGTCAAATGGTCATACTGAGGATGCAACATTTGATGGGGCTTTGAAGTGCTTTTCAAATAAAACTGGCACTAAGAGCTTAATAAAAAAAATTGGTGTAGATGTAGTTCAATTCCTTCTGGCTCATGGTTTTCAGGCTCACTTGTCAATATTGTCAAAAGGAAATGCTGGTGATAAACAAGGGGGAGACAGTGCTATTGTGGATTCGTGTCAGACTTTTATCTCTGCTTTTGATAGTTTGAGAAGCACAGATGCGCAAATGGAGATATTGTCTATAGGAAAAGAGGCACTATTTACTGCGGCAACTATTATCTTCATGAAATCATAG
Predicted protein sequences of Glyma13g24121
>Glyma13g24121.1   sequence type=predicted peptide   gene model=Glyma13g24121   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENPSSGERWSRAGIDDNMLAMFDASETKDVHQDALDDRIAFIDAVRASCEHGKPPTSKIFGAVFHMLRTGKSLELIVGSYKLLVDLDKHFPRVYLSGMDDSRSSSNSPSKLVVVKEAWAPIIGFVDKATAVSEAGDKQSGGSLDHSSFQALIEELAEILSETKFEAASMEPLRNMLIFQYLVVVFEDDFLPRNATLNWSMQRESLLSLLLGSRKINYKSLMKYFMAILCQLSQLQSELSKHPVLQESSESKLSKNCHTALSLALHGVLKDTCVSMEKLLVMIMDLDMARKIADIEGHTTRGDSPRTPLMDIILDELSYNKDSVPVFLKIFSESKWKLEIVVQYLWKYITKPSVRTRKSNGHTEDATFDGALKCFSNKTGTKSLIKKIGVDVVQFLLAHGFQAHLSILSKGNAGDKQGGDSAIVDSCQTFISAFDSLRSTDAQMEILSIGKEALFTAATIIFMKS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo