SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.01g036900

Feature Type:gene_model
Chromosome:Gm01
Start:3922226
stop:3924037
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.01g036900
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G59970.1AT Matrixin family protein JGI N/AIEA
GO:0006508GO-bp proteolysis EnsemblGenomesN/AIEA
GO:0006508GO-bp proteolysis JGI N/AIEA
GO:0016020GO-cc membrane EnsemblGenomesN/AIEA
GO:0016021GO-cc integral component of membrane EnsemblGenomesN/AIEA
GO:0031012GO-cc extracellular matrix EnsemblGenomesN/AIEA
GO:0031012GO-cc extracellular matrix JGI N/AIEA
GO:0004222GO-mf metalloendopeptidase activity EnsemblGenomesN/AIEA
GO:0004222GO-mf metalloendopeptidase activity JGI N/AIEA
GO:0008233GO-mf peptidase activity EnsemblGenomesN/AIEA
GO:0008237GO-mf metallopeptidase activity EnsemblGenomesN/AIEA
GO:0008270GO-mf zinc ion binding EnsemblGenomesN/AIEA
GO:0008270GO-mf zinc ion binding JGI N/AIEA
GO:0016787GO-mf hydrolase activity EnsemblGenomesN/AIEA
GO:0046872GO-mf metal ion binding EnsemblGenomesN/AIEA
PTHR10201Panther MATRIX METALLOPROTEINASE JGI N/AIEA
PTHR10201:SF15Panther JGI N/AIEA
PF00413PFAM Matrixin JGI N/AIEA
PF01471PFAM Putative peptidoglycan binding domain JGI N/AIEA

Proteins Associated with Glyma.01g036900
LocusGene SymbolProtein Name
MMP2 Matrix metalloproteinase 2 gene

Expression Patterns of Glyma.01g036900
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.01g036900
ParalogEvidenceComments
Glyma.02g028800 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.
Glyma.02g028700 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.01g036900 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma01g04350 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.01g036900
>Glyma.01g036900.1 sequence-type=CDS polypeptide=Glyma.01g036900.1.p locus=Glyma.01g036900 ID=Glyma.01g036900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGATGAAATCTTCTTCACATCTTTCTGCAATATTCCTATTGTTCTTTCTCCTTACTGCCCTATCCCCTTCGGATGGAGTTTCATTCTCTTCATTCCTAAAGCAATTAAAACAGAAGCTGGAGAAGAGTCCCACCCTAAAAGATTTCCTGAAACCCACCACTATAGGGGATATTTATTATACGTTGAATTTCACAGAAATCTTCTCTTCCGAAGAGAGAAGCGCACCACCGGTGTCTCTCATCAAAGATTACTTATCAAACTACGGCTACATTGAATCCTCTGGGCCATTGAGCAATTCGATGGACCAAGAAACAATAATATCAGCCATTAAGACCTACCAGCAATATTTCAGTTTGCAACCCACCGGCAAACTAAACAACGAGACTCTTCAGCAAATGTCGTTCCTACGATGTGGCGTCCCCGACATTAACATTGACTACAACTTCACCGACGACAACATGTCATATCCGAAAGCCGGTCACCGGTGGTTCCCCCACACAAACCTCACATACGGTTTTCTTCCTGAAAACCAAATCCCAGCCAACATGACCAAGGTGTTTAGAGATTCCTTCGCTCGGTGGGCCCAGGCCTCTGGGGTTTTGAATCTCACCGAGACAACCTACGACAACGCCGACATCCAAGTAGGGTTCTACAACTTCACTTACTTAGGAATTGATATCGAGGTGTATGGTGGCAGCCTTATATTTTTGCAACCCGATTCTACCAAGAAAGGGGTTATACTTCTCGACGGTACCAATAAGTTGTGGGCTCTTCCCAGTGAAAACGGTAGGTTGTCGTGGGAGGAAGGAGTTTTGGACTTGGAGAGTGCGGCAATGCACGAGATAGGGCATTTACTAGGGCTTGACCACTCTAACAAAGAGGACTCTGTTATGTACCCTTGCATATTGCCTTCACACCAACGAAAGGTGCAGCTCTCGAAATCTGATAAGACCAACGTTCAGCATCAGTTTGCTAACGTAGAGGACTCTGCAGGCCACGTAGGGCGTTTGGGAGTGAGTTTAATTACCACTTTGTCTCTTGGATTCGCTTACTTACTTCTCCTTTTGTATTAA
Predicted protein sequences of Glyma.01g036900
>Glyma.01g036900.1.p sequence-type=predicted peptide transcript=Glyma.01g036900.1 locus=Glyma.01g036900 ID=Glyma.01g036900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MMKSSSHLSAIFLLFFLLTALSPSDGVSFSSFLKQLKQKLEKSPTLKDFLKPTTIGDIYYTLNFTEIFSSEERSAPPVSLIKDYLSNYGYIESSGPLSNSMDQETIISAIKTYQQYFSLQPTGKLNNETLQQMSFLRCGVPDINIDYNFTDDNMSYPKAGHRWFPHTNLTYGFLPENQIPANMTKVFRDSFARWAQASGVLNLTETTYDNADIQVGFYNFTYLGIDIEVYGGSLIFLQPDSTKKGVILLDGTNKLWALPSENGRLSWEEGVLDLESAAMHEIGHLLGLDHSNKEDSVMYPCILPSHQRKVQLSKSDKTNVQHQFANVEDSAGHVGRLGVSLITTLSLGFAYLLLLLY*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo