SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.05g153100

Feature Type:gene_model
Chromosome:Gm05
Start:34683689
stop:34684918
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.05g153100
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G13930.1AT Chalcone and stilbene synthase family protein JGI N/AIEA
GO:0008152GO-bp metabolic process EnsemblGenomesN/AIEA
GO:0009058GO-bp biosynthetic process EnsemblGenomesN/AIEA
GO:0009058GO-bp biosynthetic process JGI N/AIEA
GO:0003824GO-mf catalytic activity EnsemblGenomesN/AIEA
GO:0016740GO-mf transferase activity EnsemblGenomesN/AIEA
GO:0016746GO-mf transferase activity, transferring acyl groups EnsemblGenomesN/AIEA
GO:0016746GO-mf transferase activity, transferring acyl groups JGI N/AIEA
GO:0016747GO-mf transferase activity, transferring acyl groups other than amino-acyl groups EnsemblGenomesN/AIEA
PF00195PFAM Chalcone and stilbene synthases, N-terminal domain JGI N/AIEA
PWY-6787SoyCyc9 flavonoid biosynthesis (in equisetum) Plant Metabolic Network ISS
PWY1F-FLAVSYNSoyCyc9 flavonoid biosynthesis Plant Metabolic Network ISS
GN7V-63900SoyCyc9-rxn naringenin-chalcone synthase Plant Metabolic Network ISS

Expression Patterns of Glyma.05g153100
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.05g153100 not represented in the dataset
Glyma.05g153100 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.05g153100
ParalogEvidenceComments
Glyma.08g109300 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.


Coding sequences of Glyma.05g153100
>Glyma.05g153100.1 sequence-type=CDS polypeptide=Glyma.05g153100.1.p locus=Glyma.05g153100 ID=Glyma.05g153100.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGTTGGTGGCGACGACGGTGATCATGATGACGATCATGATACTGGTGATTGTGGAACAACGTGCAGAATTAAATGAAGAGATCCTGAAGGAGAATCCGAGTGTCTGTGCATATATGACACCTTCATTGGATACAAGGCAAGACATGGTGATTGTGGAGGTACCAAAGTTGGGAAAAGAGGCTGCAACTAAGACAATCAAGGAATGGGGTCAACCCAAGTCCAAGATTACCCATCTCATCTTTTGCACCATCAGCGGTGTCCACATGCCTGGTGCTGATGTACCAACAAGACTGCTTTGCCGGTGGCTCCGTCTCGTCGAAAACAACAAAGGTGCTCGCGTGCTATTGGTTTGGTCTGAGATCACTGCAGTCGCAGCCTTGTTCGGAGATGGTGCAGCTGCTGGCATTGTTGGATCAGACCCCTTACCAGTTGAAAAGCCTTTGTTTCAGCTTACTATCCTTCCCGACAGCGAAGGGGCTATTAATGGCCACCTTGGCCTTGGCGAAGTTGGACTCACATTCCATCTCCTCAAGGTGGACCGGCAATTTTAG
Predicted protein sequences of Glyma.05g153100
>Glyma.05g153100.1.p sequence-type=predicted peptide transcript=Glyma.05g153100.1 locus=Glyma.05g153100 ID=Glyma.05g153100.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MLVATTVIMMTIMILVIVEQRAELNEEILKENPSVCAYMTPSLDTRQDMVIVEVPKLGKEAATKTIKEWGQPKSKITHLIFCTISGVHMPGADVPTRLLCRWLRLVENNKGARVLLVWSEITAVAALFGDGAAAGIVGSDPLPVEKPLFQLTILPDSEGAINGHLGLGEVGLTFHLLKVDRQF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo