SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g02960

Feature Type:gene_model
Chromosome:Gm09
Start:2068000
stop:2073077
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma09g02960
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G63890AT Annotation by Michelle Graham. TAIR10: histidinol dehydrogenase | chr5:25565600-25567879 REVERSE LENGTH=452 SoyBaseE_val: 0ISS
GO:0000105GO-bp Annotation by Michelle Graham. GO Biological Process: histidine biosynthetic process SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0008295GO-bp Annotation by Michelle Graham. GO Biological Process: spermidine biosynthetic process SoyBaseN/AISS
GO:0009411GO-bp Annotation by Michelle Graham. GO Biological Process: response to UV SoyBaseN/AISS
GO:0009555GO-bp Annotation by Michelle Graham. GO Biological Process: pollen development SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0004399GO-mf Annotation by Michelle Graham. GO Molecular Function: histidinol dehydrogenase activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0051287GO-mf Annotation by Michelle Graham. GO Molecular Function: NAD binding SoyBaseN/AISS
KOG2697 KOG Histidinol dehydrogenase JGI ISS
PTHR21256Panther HISTIDINOL DEHYDROGENASE (HDH) JGI ISS
PTHR21256:SF2Panther HISTIDINOL DEHYDROGENASE (HDH) JGI ISS
PF00815PFAM Histidinol dehydrogenase JGI ISS
UniRef100_I1L0G2UniRef Annotation by Michelle Graham. Best UniRef hit: Histidinol dehydrogenase, chloroplastic n=2 Tax=Glycine max RepID=I1L0G2_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1L0G2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Histidinol dehydrogenase, chloroplastic n=2 Tax=Glycine max RepID=I1L0G2_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma09g02960
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g02960
ParalogEvidenceComments
Glyma15g13910 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g02960 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g025600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma09g02960
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma09g02960
>Glyma09g02960.1   sequence type=CDS   gene model=Glyma09g02960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACAATGGAATCTGCGCTTACAGCTTCTAACTGGAACCGTTCTTTGATTCGGATTCGCCACACTAAGCCACGCTTCGGTGCAATTCGCCCCACAGCAATACGGTGCTCCATCAACTCGTATCGCTTGTCCAACCTCACTCCCTCTGAGCTTCAGAGCCTCAAGAGCCGACCCCGCATCGATTTCTCTTCCATTTTCGGTGTTGTTAATCCTATTGTCGATGATGTTCACAAAAGAGGGGATGCTGCGGTTAAAGAATACACTTCAAAGTTTGATAAAGTTGAATTGGATAAGATAGTTGAGGTTGTCTCGGAGCTCCCTGACCCTGTGCTTGAACCGCCTATTAAGGAAGCTTTTGATGTCGCCTATGATAATATTTATGCATTTCATGCTGCTCAGAAGTCATCCGAGAAAAGTGTTGAGAACATGAAAGGAGTCCAATGCAAGAGAGTTGCAAGAAGTATTAACTCTGTGGGTCTTTATGTTCCAGGGGGAACTGCTGTATTACCTTCAACAGCTTTGATGCTTGCAGTTCCTGCACAAATTGCAGGATGTAAAACTATTGTTCTTGCAAATCCTCCAACTCGGGATGGCACTACATGCAAGGAGGTACTGTATTGTGCAAAGAAGGCTGGGGTGACTCACATTCTCAAAGCTGGAGGAGCACAGGCCATATCTGCCATGGCTTGGGGAACAGAAACTTGTCCAAAGGTTGAAAAGATTTTTGGCCCTGGAAACCAATATGTCACTGCTGCAAAAATGATACTTCAAAACAGTGAAGCCATGATTTCGATTGACATGCCGGCCGGTCCATCCGAAGTTTTGGTCATTGCAGACAAGCATGCAATTCCTTCCCATGTAGCTGCTGATTTGCTTTCCCAGGCAGAGCATGGCCCAGATAGTCAGGTTGTTCTTGTGATTGCTGGAGATGGTGTGGATCTGAATGCAATACAGGAGGAACTCAGCAAGCAGTGTGACAGTCTTCCAAGAGGCGAGTTTGCCTCTAAAGCTCTGAGCCATAGTTTTTTTGTGTATGCGTGTGATATGCTTGAGGCTATCAATTTCTCAAACTTATATGCACCTGAACATCTAATTATCAACGTGAAGGATGCAGAGAAGTGGGAGAGTTTTATTGAGAATGCAGGTTCTGTGTTCTTAGGGCCTTGGACTCCTGAGAGTGTTGGTGATTATGCAAGTGGGACAAACCATGTCCTTCCTACTTACGGTTATGCAAGAATGTATGGTGGTGTGTCATTGGACTCCTTCCTGAAGTACATAACTGTGCAGTCTCTCTCAGAGGAAGGTCTAAGAAGGCTTGGGCCATATGTAGCAACCATGGCTGAAGTTGAAGGCCTTGAAGCCCACAAGCGAGCAGTTACCTTGAGACTTCAGTACATAGAAGCCAGGCAGGTTTCAAGATGA
Predicted protein sequences of Glyma09g02960
>Glyma09g02960.1   sequence type=predicted peptide   gene model=Glyma09g02960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTMESALTASNWNRSLIRIRHTKPRFGAIRPTAIRCSINSYRLSNLTPSELQSLKSRPRIDFSSIFGVVNPIVDDVHKRGDAAVKEYTSKFDKVELDKIVEVVSELPDPVLEPPIKEAFDVAYDNIYAFHAAQKSSEKSVENMKGVQCKRVARSINSVGLYVPGGTAVLPSTALMLAVPAQIAGCKTIVLANPPTRDGTTCKEVLYCAKKAGVTHILKAGGAQAISAMAWGTETCPKVEKIFGPGNQYVTAAKMILQNSEAMISIDMPAGPSEVLVIADKHAIPSHVAADLLSQAEHGPDSQVVLVIAGDGVDLNAIQEELSKQCDSLPRGEFASKALSHSFFVYACDMLEAINFSNLYAPEHLIINVKDAEKWESFIENAGSVFLGPWTPESVGDYASGTNHVLPTYGYARMYGGVSLDSFLKYITVQSLSEEGLRRLGPYVATMAEVEGLEAHKRAVTLRLQYIEARQVSR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo