SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g27300

Feature Type:gene_model
Chromosome:Gm13
Start:30471374
stop:30477690
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g27300
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G08040AT Annotation by Michelle Graham. TAIR10: MATE efflux family protein | chr3:2566593-2569397 REVERSE LENGTH=526 SoyBaseE_val: 6.00E-138ISS
GO:0006826GO-bp Annotation by Michelle Graham. GO Biological Process: iron ion transport SoyBaseN/AISS
GO:0006855GO-bp Annotation by Michelle Graham. GO Biological Process: drug transmembrane transport SoyBaseN/AISS
GO:0006879GO-bp Annotation by Michelle Graham. GO Biological Process: cellular iron ion homeostasis SoyBaseN/AISS
GO:0010106GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to iron ion starvation SoyBaseN/AISS
GO:0010167GO-bp Annotation by Michelle Graham. GO Biological Process: response to nitrate SoyBaseN/AISS
GO:0010413GO-bp Annotation by Michelle Graham. GO Biological Process: glucuronoxylan metabolic process SoyBaseN/AISS
GO:0015706GO-bp Annotation by Michelle Graham. GO Biological Process: nitrate transport SoyBaseN/AISS
GO:0045492GO-bp Annotation by Michelle Graham. GO Biological Process: xylan biosynthetic process SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0071281GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to iron ion SoyBaseN/AISS
GO:0071369GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to ethylene stimulus SoyBaseN/AISS
GO:0071732GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to nitric oxide SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0005215GO-mf Annotation by Michelle Graham. GO Molecular Function: transporter activity SoyBaseN/AISS
GO:0015137GO-mf Annotation by Michelle Graham. GO Molecular Function: citrate transmembrane transporter activity SoyBaseN/AISS
GO:0015238GO-mf Annotation by Michelle Graham. GO Molecular Function: drug transmembrane transporter activity SoyBaseN/AISS
GO:0015297GO-mf Annotation by Michelle Graham. GO Molecular Function: antiporter activity SoyBaseN/AISS
PTHR11206Panther MULTIDRUG RESISTANCE PUMP JGI ISS
PTHR11206:SF3Panther ETHIONINE RESISTANCE GENE PRODUCT-RELATED JGI ISS
PF01554PFAM MatE JGI ISS
UniRef100_G7IZF7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ferric reductase defective 3b n=1 Tax=Medicago truncatula RepID=G7IZF7_MEDTR SoyBaseE_val: 0ISS
UniRef100_UPI000233BD97UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233BD97 related cluster n=1 Tax=unknown RepID=UPI000233BD97 SoyBaseE_val: 0ISS

Expression Patterns of Glyma13g27300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g27300
ParalogEvidenceComments
Glyma12g36620 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g27300 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g203000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g27300
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g27300
>Glyma13g27300.2   sequence type=CDS   gene model=Glyma13g27300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGACGAGAATAGAAGTTCCAACGAACCCAACAAGTGGAAGATGCCTCTCTTCGTTTTCTTCAAAGATGCAAGGAATGTTTTCAAGCTGGATGCTCTATCTCGGGAGATATTAGGGATTGCACTCCCCTCAGCACTGGCCGTTTCTGCTGATCCAATTGCTTCTCTCATAGACACAGCATTCATAGGCCGTTTAGGACCGGTGGAACTTGCAGCTGCTGGAGTTTCCATTTCTTTGTTGAACCAAGCTTCGAGGATTACCATATTCCCTCTGGTCAACATTACCACTTCCTTTGTGGCTGAAGAAGATACCATTCAAAAACTGAACACCAAAGCAGCTGAAAATGGTAATAGTAAGGCCAAGTTCGGCGAAACAATTGTGCCAGAGGATCATATGCTTCAAGACATGGAAAAAGGTACCCCCAAAGTGATGAATACTGACGCTCCAACAGAATTTAGGGAAGATAAAGATGAATCACAGGAATATAATGCTACCGGCAACAATGACACAAATATTGGAGATGGAGCCAATACAATATGCAAGTTTTCATCGGTTACTAGCAGTAAGAAGAGTAAGGACAAAGTTGGAAAGAAAAAGCGACTTATTGCTTCAGCATCAACAGCACTACTTTTTGGCACAATCCTTGGTCTCATTCAAGCTGCAGTTCTTATATTTGCAACCAAACCTCTGTTAGGTGTTATGGGTGTCAAACGAGATTCTCCTATGCTAAAACCTGCAGAGAGCTACTTAAGATTGAGATCGTTCGGGGCACCAGCAGTACTTCTCTCCTTGGCCATGCAAGGCATCTTTCGAGGGTTCAAGGATACAACAACTCCTTTATATGTCATCGTTTCGGGATATGCATTGAATGTCATATTGGACCCAATTTTTATTTTCACATTGAAGTTAGGCATCAAAGGTGCAGCCATTGCACATGTTCTCTCCCAGTACATGATGGCATTCACTCTCTTATTGATATTAATGAAAAAAGTGCATCTCCTACCTCCAAGAATAAAGGATTTACAGATTTTCCGATTTCTTAAAAATGGAGGATTGTTGATGCTAAAGGTAATAGCAGTCACATTTTGTGTTACCTTAGCAACATCATTGGCTGCAAGGCTAGGTTCAATTCCCATGGCTGCATTTCAAACATGCCTACAGGTCTGGATGACATCGTCCCTTCTTGCAGATGGTTTGGCTGTTGCTGTTCAGGCAATTCTAGCTTGTTCTTTTACTGAGAAAGACTATAAGAAGCAACAGCAGCAGCAACAAGGACACTGCAAATGA
Predicted protein sequences of Glyma13g27300
>Glyma13g27300.2   sequence type=predicted peptide   gene model=Glyma13g27300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDENRSSNEPNKWKMPLFVFFKDARNVFKLDALSREILGIALPSALAVSADPIASLIDTAFIGRLGPVELAAAGVSISLLNQASRITIFPLVNITTSFVAEEDTIQKLNTKAAENGNSKAKFGETIVPEDHMLQDMEKGTPKVMNTDAPTEFREDKDESQEYNATGNNDTNIGDGANTICKFSSVTSSKKSKDKVGKKKRLIASASTALLFGTILGLIQAAVLIFATKPLLGVMGVKRDSPMLKPAESYLRLRSFGAPAVLLSLAMQGIFRGFKDTTTPLYVIVSGYALNVILDPIFIFTLKLGIKGAAIAHVLSQYMMAFTLLLILMKKVHLLPPRIKDLQIFRFLKNGGLLMLKVIAVTFCVTLATSLAARLGSIPMAAFQTCLQVWMTSSLLADGLAVAVQAILACSFTEKDYKKQQQQQQGHCK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo