SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma20g03275

Feature Type:gene_model
Chromosome:Gm20
Start:2975743
stop:2977675
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma20g03275
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G03160AT Annotation by Michelle Graham. TAIR10: FZO-like | chr1:761321-765091 FORWARD LENGTH=740 SoyBaseE_val: 6.00E-85ISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0009228GO-bp Annotation by Michelle Graham. GO Biological Process: thiamine biosynthetic process SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009902GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast relocation SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0016226GO-bp Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0034660GO-bp Annotation by Michelle Graham. GO Biological Process: ncRNA metabolic process SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0042793GO-bp Annotation by Michelle Graham. GO Biological Process: transcription from plastid promoter SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0031969GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast membrane SoyBaseN/AISS
GO:0003924GO-mf Annotation by Michelle Graham. GO Molecular Function: GTPase activity SoyBaseN/AISS
GO:0004789GO-mf Annotation by Michelle Graham. GO Molecular Function: thiamine-phosphate diphosphorylase activity SoyBaseN/AISS
GO:0005525GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP binding SoyBaseN/AISS
PTHR11649Panther MSS1/TRME-RELATED GTP-BINDING PROTEIN JGI ISS
PTHR11649:SF44Panther JGI ISS
PF00350PFAM Dynamin family JGI ISS
UniRef100_G7IED3UniRef Annotation by Michelle Graham. Most informative UniRef hit: GTP-binding protein engA n=1 Tax=Medicago truncatula RepID=G7IED3_MEDTR SoyBaseE_val: 2.00E-98ISS
UniRef100_I1JFA7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JFA7_SOYBN SoyBaseE_val: 2.00E-104ISS

Expression Patterns of Glyma20g03275
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma20g03275 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.20g026900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma20g03275
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma20g03275
>Glyma20g03275.1   sequence type=CDS   gene model=Glyma20g03275   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTGAATGAAGTTATTGAAGTTATGAAGAGGGTTGCACCTCTGATATTGGAGGAGGTTTCACTTCTTAATGATGCGGTTTCTCAAATTGATGAGCCATGCTTACTGGTAATAGCGGGGAAATTCAACTCTGGTAAATCTACTGTGATTAATGCGCTTCTTGGAGAAAGATATCTCAATGAGGGAGTTGCTCCAACAACTAATGAGATCACATTTTTACGATATACTGACTTAGATATTGAACAACAACAGTGTGAAAGGCATCTAGATGGTCAATATATTTGCTACATTCCTGCTCCAATTCTTAAGGAGATGACCATTGTTGATACACCTGGAACTAATGTGATTCTTCAGAGGCAGCAACATCTTACAGAGGAATTTGTACCTTGTGTAGATTTACTTCTTTTTGTTATTTTTGCTGATCACCCTTTAACTGGAAGTGAGATTGCTTTTCTTCGTTATTCTCAGCAGTGGAAAAAGAAAGCGGTTTTTGTCTTGAATAAAGCTGACATATATCAGAATAATCATGAGGTCAGCCTATTATGCAGCAACTGA
Predicted protein sequences of Glyma20g03275
>Glyma20g03275.1   sequence type=predicted peptide   gene model=Glyma20g03275   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLNEVIEVMKRVAPLILEEVSLLNDAVSQIDEPCLLVIAGKFNSGKSTVINALLGERYLNEGVAPTTNEITFLRYTDLDIEQQQCERHLDGQYICYIPAPILKEMTIVDTPGTNVILQRQQHLTEEFVPCVDLLLFVIFADHPLTGSEIAFLRYSQQWKKKAVFVLNKADIYQNNHEVSLLCSN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo