| Locus Type: | SSR |
Maps Containing BARCSOYSSR_10_1394
Some of the BARCSOYSSR loci were previously genetically mapped under
a different name. In these cases the SoyBase genetic maps use the
original name which will be highlighted on the maps.
Comments About the Locus
| The QTL were provided by 392 F4 : 6 lines (constituting seven populations) that were derived from seven crosses involving a partially resistant variety ?Skylla,? five partially resistant PIs, and a known susceptible line ?E00290?. Skylla carries resistance to SWM from a cultivar ?NKS 19-90?. NKS 19?90 has partial resistance to SWM and is reported to harbor SWM resistance QTL. The five PIs: PI 89001, PI 153259, PI 437764, PI 548404, and PI 548312 were reported to have resistance level comparable to that of NKS 19?90. QTL is classified as the reaction to Sclerotinia sclertiorum infection. |
Genomic Sequence Information for BARCSOYSSR_10_1394
| Chromosome | Start Pos | End Pos | Motif | Derived From | Polymorphic* | Assembly Version |
|---|
| Gm10 | 44000026 | 44000070 | (AAT)15 | Wm82 | unknown | Glyma 1.0 |
| Gm10 | 44580197 | 44580241 | (AAT)15 | Wm82 | unknown | Glyma 2.0 |
*Polymorphic in the following germplasms:
Williams 82,
Noir 1,
Minsoy,
Archer,
Evans,
Peking,
Essex, and
PI 468916
QTLs Associated with BARCSOYSSR_10_1394
Amplification Info for BARCSOYSSR_10_1394
More than one entry indicates that this SSR was independently identified by different labs sometimes using
separate methodology resulting in unique primer pairs.
| Name | BARCSOYSSR_10_1394 |
| Primer1 | GAAAAACGAAAAAGCAACGG |
| Primer2 | TTTTCGGGTCACTTTTGGTC |
| Motif | (AAT)15 |
| | |
Information Providers
| Song, Qijian and Cregan, Perry |
SoyBase
Follow us on Twitter @SoyBaseDatabase
