SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt022
Map NamePosition
GmComposite2003_N 102.05
GmConsensus40_N 84.453


Genomic Sequence Information for Satt022
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm03 4468261544682665(TAT)17Wm82yesGlyma 1.0
Gm03 4267582942676034(TAT)17Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt022
Leaflet chlorophyll 1-3
Leaflet shape, UV-B induced 1-1
Leaflet width 8-15
Leaflet width 9-7
mqSeed Oil-025
Petiole color, UV-B induced 1-1
Plant damage, UV-B induced 1-1
Plant height 26-17
Pod wall to Pod weight ratio 1-4
Seed length 1-4
Seed linoleic 6-1
Seed number 6-2
Seed oil 24-34
Seed oil 28-3
Seed oil 36-9
Seed oil 43-30
Seed oleic 6-1
Seed protein 36-34
Seed protein 36-35
Seed stearic 6-5
Seed thickness 1-2
Seed weight 46-2
Seed weight per plant 5-3
Whitefly resistance 1-3


Amplification Info for Satt022
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt022
Primer1GGGGGATCTGATTGTATTTTACCT
Primer2CGGGTTTCAAAAAACCATCCTTAC
Motif(TAT)17
    
NameBARCSOYSSR_03_1540
Primer1GGGGGATCTGATTGTATTTTACCT
Primer2CGGGTTTCAAAAAACCATCCTTAC
Motif(TAT)17
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt022
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo