LocusName Satt100 - SoyBase

SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type: SSR

Maps Containing Satt100

Map Name	Position
GmComposite2003_C2	113.95
GmConsensus40_C2	102.941

Genomic Sequence Information for Satt100

Chromosome	Start Pos	End Pos	Motif	Derived From	Polymorphic*	Assembly Version
Gm06	30668416	30668454	(TTA)13	Wm82	yes	Glyma 1.0
Gm06	31490622	31490787	(TTA)13	Wm82	yes	Glyma 2.0

*Polymorphic in the following germplasms:
Williams 82, Noir 1, Minsoy, Archer, Evans, Peking, Essex, and PI 468916

QTLs Associated with Satt100

First flower 18-1

First flower 20-1

First flower 22-2

First flower 26-18

Flood tolerance 4-1

Hypocotyl weight 1-3

Leaflet shape 8-5

Leaflet shape 9-4

Leaflet shape, UV-B induced 10-2

Node number 4-2

Phomopsis seed decay 3-1

Phomopsis seed decay 4-1

Plant height 29-1

Plant height 30-1

Plant height 35-2

Pod maturity 25-1

Pod maturity 28-4

Pod maturity 32-2

Pod maturity 33-2

Pod maturity 34-2

Pods per node 3-1

Seed coat color 1-3

Seed oligosaccharide 2-2

Seed protein 28-1

Seed protein 29-1

Seed protein 35-2

Seed weight 31-1

Seed weight 34-2

Seed weight 35-2

Seed weight 40-3

Seed yield 28-4

Seed, beginning 3-1

Amplification Info for Satt100

More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.

Name	Satt100
Primer1	ACCTCATTTTGGCATAAA
Primer2	TTGGAAAACAAGTAATAATAACA
Motif	(TTA)13

Name	BARCSOYSSR_06_1202
Primer1	ACCTCATTTTGGCATAAA
Primer2	TTGGAAAACAAGTAATAATAACA
Motif	(TTA)13

Information Providers

Song, Qijian and Cregan, Perry

References for Satt100

Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain