SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt150
Map NamePosition
GmComposite2003_M 18.58
GmConsensus40_M 16.862


Genomic Sequence Information for Satt150
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm07 24144652414524(ATA)20Wm82yesGlyma 1.0
Gm07 24342592434459(ATA)20Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt150
First flower 4-2
Leaflet area 4-3
Leaflet chlorophyll 1-13
Leaflet length 3-2
Leaflet width 3-2
Plant height 10-2
Plant height 21-3
Plant height 37-4
Plant height 8-2
Plant height to Lodging ratio 2-1
Pod maturity 13-7
Pod maturity 18-4
Pod maturity 8-2
Reproductive stage length 2-1
Seed abortion 1-2
Seed height 1-7
Seed length 1-6
Seed protein 36-33
Seed set 1-7
Seed thickness 1-5
Seed volume 1-6
Seed weight 35-11
Seed weight 47-1
Seed weight 49-15
Seed weight 7-6
Seed width 1-5
Seed yield 11-7
Seed yield 19-4
Seed yield 6-1
Seed yield to Plant height ratio 2-2
Seed yield to weight ratio 3-3


Amplification Info for Satt150
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt150
Primer1AAGCTTGAGGTTATTCGAAAATGAC
Primer2TGCCATCAGGTTGTGTAAGTGT
Motif(ATA)20
    
NameBARCSOYSSR_07_0134
Primer1AAGCTTGAGGTTATTCGAAAATGAC
Primer2TGCCATCAGGTTGTGTAAGTGT
Motif(ATA)20
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt150
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo