SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt166
Map NamePosition
GmComposite2003_L 66.51
GmConsensus40_L 45.994


Genomic Sequence Information for Satt166
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm19 4241549742415553(TTA)19Wm82yesGlyma 1.0
Gm19 4261647342616724(TTA)19Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt166
First flower 4-4
Flower number 1-10
Leaflet shape 6-16
Leaflet shape 7-11
Photoperiod insensitivity 3-2
Plant height 8-4
Plant weight, dry 1-2
Pod dehiscence 3-5
Pod maturity 8-4
Seed coat cracking 3-7
Seed height 1-10
Seed height 1-11
Seed length 1-10
Seed length 4-8
Seed oil 23-4
Seed oligosaccharide 2-7
Seed protein 8-1
Seed volume 1-7
Seed volume 1-8
Seed width 1-8
Seed yield to Plant height ratio 2-6
Shoot weight, dry 4-3


Amplification Info for Satt166
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt166
Primer1TTGCACAGTTGATTTTTGTTT
Primer2GCATCGAATTTCTGGATTTAC
Motif(TTA)19
    
NameBARCSOYSSR_19_1195
Primer1TTGCACAGTTGATTTTTGTTT
Primer2GCATCGAATTTCTGGATTTAC
Motif(TTA)19
    

References for Satt166
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo