SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt251
Map NamePosition
GmComposite2003_B1 36.48
GmConsensus40_B1 38.802


Genomic Sequence Information for Satt251
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm11 68965836896627(TAT)15Wm82yesGlyma 1.0
Gm11 69064656906676(TAT)15Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt251
Branching 3-3
Flower number 1-5
Lodging 10-1
Node number 3-6
Nodule number 1-1
Nodule weight per plant, dry 1-4
Plant height 24-6
Plant height 26-6
Plant height 26-7
Pod number 1-5
Pod number 3-2
Pod wall width 1-5
Pod wall width 1-6
Pod wall width 1-7
Seed oil 24-11
Seed protein 16-1
Seed protein 37-1
Seed yield 22-1


Amplification Info for Satt251
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt251
Primer1CCTCCACCCCCTTCCCACCCAAAA
Primer2GGTGATATCGCGCTAAAATTA
Motif(TAT)15
    
NameBARCSOYSSR_11_0375
Primer1CCTCCACCCCCTTCCCACCCAAAA
Primer2GGTGATATCGCGCTAAAATTA
Motif(TAT)15
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt251
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo