SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt274
Map NamePosition
GmComposite2003_D1b 116.34
GmConsensus40_D1b 118.62


Genomic Sequence Information for Satt274
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm02 4834594848346001(TAT)18Wm82yesGlyma 1.0
Gm02 4526704045267222(TAT)18Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt274
P use efficiency 1-2
Phytoph 10-3
Plant P 3-5
Plant weight, dry 1-5
Root density, lateral 2-2
Root weight, dry 3-4
Seed Arg 1-1
Seed coat cracking 3-3
Seed coat hardness 2-2
Seed Glu 1-3
Seed Gly 1-3
Seed Leu 1-2
Seed N at R5 1-4
Seed oil 19-1
Seed oil 24-3
Seed oil 39-6
Seed oil 43-9
Seed Phe 1-2
Seed protein 36-11
Seed protein 37-4
Seed Thr 1-3
Seed tocopherol, alpha 2-3
Seed tocopherol, gamma 2-5
Seed Tyr 1-2
Seed weight 37-10
Seed weight 49-9
Seed winter hardiness 1-3
Shoot weight, dry 4-2


Amplification Info for Satt274
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt274
Primer1GCGGGGTCAATTAGTTTTCGTCAGTT
Primer2GCGCACGGTATATAATCGAACCTAT
Motif(TAT)18
    
NameBARCSOYSSR_02_1663
Primer1GCGGGGTCAATTAGTTTTCGTCAGTT
Primer2GCGCACGGTATATAATCGAACCTAT
Motif(TAT)18
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt274
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo