SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt277
Map NamePosition
GmComposite2003_C2 107.58
GmConsensus40_C2 98.344


Genomic Sequence Information for Satt277
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm06 1717388717174009(ATA)41Wm82yesGlyma 1.0
Gm06 1721867717218911(ATA)41Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt277
First flower 18-2
First flower 26-6
Flood tolerance 4-1
Internode length 2-2
Internode length 2-5
Leaflet chlorophyll 1-9
Lodging 27-2
Lodging 6-1
Phytoph 6-7
Plant height 17-6
Plant height 17-9
Plant height 30-2
Plant height 35-1
Plant height 8-1
Pod maturity 25-2
Pod maturity 28-3
Pod maturity 34-1
Pod number 3-3
Pod number 3-4
Pod number 7-2
Pod wall width 1-3
Pods per node 3-2
Reproductive period 1-1
SDS 11-1
Seed coat hardness 2-1
Seed glycitein 10-1
Seed length 1-5
Seed number 2-1
Seed oil 23-1
Seed oil 27-1
Seed oil 30-5
Seed oil 33-2
Seed oil plus protein 1-3
Seed protein 24-1
Seed protein 26-7
Seed protein 35-1
Seed set 4-2
Seed set 5-12
Seed stearic 5-2
Seed tocopherol, alpha 2-2
Seed weight 15-1
Seed weight 31-2
Seed weight 34-16
Seed weight 36-16
Seed weight 40-2
Seed weight 43-1
Seed weight 49-7
Seed weight 6-5
Seed weight per plant 5-1
Seed winter hardiness 1-2
Seed yield 19-2
Seed yield 21-1
Seed yield 25-6
Seed yield 28-3
Seed yield 5-1
Seed yield 7-1
Seed yield to Plant height ratio 2-1
Seed, beginning 3-2
Somatic emb per explant 4-2


Amplification Info for Satt277
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt277
Primer1GGTGGTGGCGGGTTACTATTACT
Primer2CCACGCTTCAGTTGATTCTTACA
Motif(ATA)41
    
NameBARCSOYSSR_06_0920
Primer1GGTGGTGGCGGGTTACTATTACT
Primer2CCACGCTTCAGTTGATTCTTACA
Motif(ATA)41
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt277
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo