SoyBase NEW SoyBase for review!
Integrating Genetics and Genomics to Advance Soybean Research



Locus Type:  SSR


Map NamePosition
GmComposite2003_C2 101.75
GmConsensus40_C2 92.477


ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm06 1617186016171913(ATT)18Wm82yesGlyma 1.0
Gm06 1622104416221254(ATT)18Wm82yesGlyma 2.0


First flower 26-4
Internode length 2-2
Internode length 2-4
Node number 7-2
Node number 7-3
Photoperiod insensitivity 2-1
Pod maturity, beginning 2-1
Pod, beginning 2-1
R/V photo-thermal sensitivity 1-1
Root area 3-1
Root area, coarse 1-1
Root area, fine plus Rhizobia 1-1
Root area, medium 1-1
Root length plus Rhizobia 1-1
Root length, coarse 1-1
Root length, fine plus Rhizobia 1-1
Root length, medium 1-1
Root nodule number, big 1-1
Root nodule number, big 1-4
Root nodule weight, dry 3-1
Root volume 2-1
Root volume, coarse 1-1
Root volume, fine plus Rhizobia 1-1
Root volume, medium 1-1
Root weight, dry 4-1
Seed glycinin 2-5
Seed glycinin plus beta-conglycinin 1-6
Seed protein 36-7
Seed tocopherol, gamma 1-3
Seed tocopherol, gamma 2-3
Seed tocopherol, total 1-2
Seed tocopherol, total 2-2
Seed yield 22-12
Shoot weight, dry 6-1
Somatic embryogenesis 1-2


NameSatt286
Primer1GCGGCGTTAATTTATGCCGGAAA
Primer2GCGTTTGGTCTAGAATAGTTCTCA
Motif(ATT)18
    
NameBARCSOYSSR_06_0863
Primer1GCGGCGTTAATTTATGCCGGAAA
Primer2GCGTTTGGTCTAGAATAGTTCTCA
Motif(ATT)18
    


Song, Qijian and Cregan, Perry

Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo