SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt373
Map NamePosition
GmComposite2003_L 107.23
GmConsensus40_L 93.953


Genomic Sequence Information for Satt373
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm19 4919133649191398(TAT)21Wm82yesGlyma 1.0
Gm19 4931267549312922(TAT)21Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt373
First flower 5-3
First flower 8-3
Leaflet length 4-3
Leaflet shape 6-19
Leaflet shape 7-14
Leaflet width 7-9
Nodule weight per plant, dry 1-11
Plant height 9-2
Pod maturity 9-3
Pod number 1-9
Reproductive stage length 3-3
Reproductive stage length 7-4
Seed coat hardness 2-5
Seed conglycinin, beta 2-6
Seed daidzein 8-2
Seed oil 23-5
Seed protein 16-2
Seed set 5-44
Seed yield 22-9
Seed yield to Plant height ratio 3-2


Amplification Info for Satt373
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt373
Primer1TCCGCGAGATAAATTCGTAAAAT
Primer2GGCCAGATACCCAAGTTGTACTTGT
Motif(TAT)21
    
NameBARCSOYSSR_19_1543
Primer1TCCGCGAGATAAATTCGTAAAAT
Primer2GGCCAGATACCCAAGTTGTACTTGT
Motif(TAT)21
    

References for Satt373
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo