SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt424
Map NamePosition
GmComposite2003_A2 60.59
GmConsensus40_A2 53.554


Genomic Sequence Information for Satt424
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm08 1072172310721881(TTA)53Wm82yesGlyma 1.0
Gm08 1063364510633908(TTA)53Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt424
Flood tolerance 7-2
Internode length 1-4
Root weight, dry 1-1
Root weight, fresh 1-2
Sclero 2-2
Sclero 3-2
Sclero 5-1
Sclero 6-2
SCN 29-5
SCN 30-3
SCN 45-4
Seed coat hardness 3-1
Seed oil 43-1
Seed set 5-17
Seed weight 34-10
Seed weight 36-10
Seed winter hardiness 1-1
Seed winter hardiness 2-1
shoot weight, dry 1-1
shoot weight, fresh 1-1


Amplification Info for Satt424
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt424
Primer1CAACCTGTATTCCACAAAAAATCTCACC
Primer2GCGCCCCAATTTGACTATAAATAAAAGT
Motif(TTA)53
    
NameBARCSOYSSR_08_0579
Primer1CAACCTGTATTCCACAAAAAATCTCACC
Primer2GCGCCCCAATTTGACTATAAATAAAAGT
Motif(TTA)53
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt424
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo