SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Locus Type:  SSR


Maps Containing Satt557
Map NamePosition
GmComposite2003_C2 112.19
GmConsensus40_C2 102.229


Genomic Sequence Information for Satt557
ChromosomeStart PosEnd PosMotifDerived FromPolymorphic*Assembly Version
Gm06 2001884520018907(AAT)17(GAT)4Wm82yesGlyma 1.0
Gm06 2021889320219096(AAT)17(GAT)4Wm82yesGlyma 2.0

*Polymorphic in the following germplasms:
Williams 82,  Noir 1,  Minsoy,  Archer,  Evans,  Peking,  Essex, and   PI 468916


QTLs Associated with Satt557
First flower 22-2
First flower 26-11
Photoperiod insensitivity 3-1
Photoperiod insensitivity 4-1
Phytoph 5-1
Plant height 25-4
Pod maturity 13-4
Pod maturity 19-5
Reproductive period 1-4
Reproductive to vegetative period ratio 1-1
Seed protein 28-1
Seed weight 34-15
Seed yield 19-3
Seed yield 23-5
Total growth duration 1-1
Total growth duration 1-4
Vegetative period 1-1
Vegetative period 1-3


Amplification Info for Satt557
More than one entry indicates that this SSR was independently identified by different labs sometimes using separate methodology resulting in unique primer pairs.
NameSatt557
Primer1GCGGGATCCACCATGTAATATGTG
Primer2GCGCACTAACCCTTTATTGAA
Motif(AAT)17(GAT)4
    
NameBARCSOYSSR_06_1041
Primer1GCGGGATCCACCATGTAATATGTG
Primer2GCGCACTAACCCTTTATTGAA
Motif(AAT)17(GAT)4
    


Information Providers
Song, Qijian and Cregan, Perry

References for Satt557
Cregan et al. 1999A An integrated genetic linkage map of the soybean genome Crop Sci. 1999, 39(5):1464-1490






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo